OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HES7 (NM_032580) Human Untagged Clone

Be the first to review this product
SKU
SC305482
HES7 (untagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HES7 or NM_032580"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HES7
Synonyms bHLHb37; SCDO4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032580, the custom clone sequence may differ by one or more nucleotides


ATGGTCACCCGGGATCGAGCTGAGAATAGGGACGGCCCCAAGATGCTCAAGCCGCTTGTGGAGAAGCGGC
GCCGGGACCGCATCAACCGCAGCCTGGAAGAGCTGAGGCTGCTGCTGCTGGAGCGGACCCGGGACCAGAA
CCTCCGGAACCCGAAGCTGGAGAAAGCGGAGATATTGGAGTTCGCCGTGGGCTACTTGAGGGAGCGAAGC
CGGGTGGAGCCCCCGGGGGTTCCCCGGTCCCCAGTCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGT
CCGGTTTCCGCGAGTGCCTGCTTCGCTTGGCGGCCTTCGCGCACGACGCCAGCCCGGCCGCCCGCGCCCA
GCTCTTCTCCGCGCTGCACGGCTATCTGCGCCCCAAACCGCCCCGGCCCAAGCCGGTAGATCCGAGGCCT
CCAGCGCCGCGCCCATCCCTGGACCCCGCCGCACCGGCCCTTGGCCCTGCGCTGCACCAGCGCCCCCCAG
TGCACCAGGGCCACCCTAGCCCGCGCTGCGCATGGTCCCCATCCCTCTGCTCCCCGCGCGCCGGGGATTC
TGGCGCGCCGGCGCCCCTCACCGGACTGCTGCCGCCGCCACCGCCGCCTCACAGACAAGACGGGGCGCCC
AAGGCCCCGCTGCCCCCGCCGCCCGCTTTCTGGAGACCTTGGCCCTGA
Restriction Sites Please inquire |
ACCN NM_032580
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032580.1, NP_115969.1
RefSeq Size 678 bp
RefSeq ORF 678 bp
Locus ID 84667
UniProt ID F8VPC9
Cytogenetics 17p13.1
Summary This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.provided by RefSeq, Sep 2009
Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (2) lacks a five amino acid segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_032580" in other vectors (6)
SKU Description Size Price
RC219701 HES7 (Myc-DDK-tagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2 10 ug
$300.00
RC219701L1 Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC219701L2 Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, mGFP tagged 10 ug
$600.00
RC219701L3 Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC219701L4 Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, mGFP tagged 10 ug
$600.00
RG219701 HES7 (tGFP-tagged) - Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products