OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TRMT5 (NM_020810) Human Untagged Clone

Be the first to review this product
SKU
SC304838
TRMT5 (untagged)-Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5)
  $522.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA809321 TRMT5 mouse monoclonal antibody,clone OTI1B5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TRMT5 or NM_020810"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRMT5
Synonyms COXPD26; KIAA1393; TRM5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304838 representing NM_020810.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGCTTTGGATCTTATGGAGGCCATTTGGATTCTCAGGAAGATTTCTGAAACTGGAAAGCCATAGC
ATAACTGAATCAAAATCGTTGATTCCAGTAGCTTGGACATCCCTGACACAGATGCTTTTGGAAGCACCT
GGTATTTTCTTATTGGGTCAAAGAAAAAGATTCTCAACCATGCCAGAAACAGAAACACATGAGAGAGAG
ACTGAATTGTTTTCACCACCTTCTGATGTCCGAGGCATGACAAAACTTGATAGAACAGCTTTTAAAAAG
ACAGTCAACATTCCAGTGCTTAAAGTGAGGAAAGAAATAGTCAGTAAATTGATGCGATCCCTAAAAAGG
GCAGCATTGCAGCGCCCAGGCATAAGACGTGTGATTGAAGATCCGGAAGATAAAGAAAGTAGACTAATC
ATGTTGGATCCCTATAAAATATTTACTCATGATTCCTTTGAGAAAGCAGAACTCAGTGTTTTAGAGCAG
CTTAATGTCAGTCCACAGATCTCTAAATACAATTTGGAACTAACATATGAACACTTTAAGTCAGAAGAA
ATCTTGAGAGCTGTGCTTCCTGAAGGTCAAGATGTAACTTCAGGGTTTAGCAGGATTGGACATATTGCA
CACCTAAACCTTCGAGATCATCAGCTGCCTTTCAAACATTTAATTGGCCAGGTTATGATTGACAAAAAT
CCAGGAATCACCTCAGCAGTAAATAAAATAAATAATATTGACAATATGTACCGAAATTTCCAAATGGAA
GTGCTATCTGGAGAGCAGAACATGATGACAAAGGTTCGAGAAAACAACTACACCTATGAATTTGATTTT
TCAAAAGTCTATTGGAATCCTCGTCTGTCTACAGAACACAGCCGTATCACAGAACTTCTCAAACCTGGG
GATGTCCTATTTGATGTTTTTGCTGGGGTTGGGCCCTTTGCCATTCCAGTAGCAAAGAAAAACTGCACT
GTATTTGCCAATGATCTCAATCCTGAATCTCATAAATGGCTGTTGTACAACTGTAAATTAAATAAAGTG
GACCAAAAGGTGAAAGTCTTCAACTTGGATGGGAAAGACTTCCTCCAAGGACCAGTCAAAGAAGAGTTA
ATGCAGCTGCTGGGTCTGTCAAAAGAAAGAAAACCCTCTGTGCACGTTGTCATGAACTTGCCAGCAAAA
GCTATAGAGTTTCTTAGTGCTTTCAAGTGGCTTTTAGATGGGCAGCCATGCAGCAGTGAGTTCCTTCCC
ATAGTGCATTGTTATAGCTTTTCCAAAGATGCTAACCCTGCTGAGGATGTTCGGCAAAGGGCTGGAGCT
GTGTTAGGCATTTCTCTGGAGGCATGCAGTTCAGTTCACCTGGTAAGAAATGTGGCCCCAAACAAGGAA
ATGCTGTGCATCACGTTTCAGATTCCTGCCTCTGTCCTCTACAAGAACCAGACCAGAAATCCAGAGAAT
CATGAAGATCCACCTCTTAAAAGGCAGAGGACGGCTGAAGCCTTTTCAGACGAAAAAACACAAATTGTT
TCAAACACTTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_020810
Insert Size 1530 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020810.3
RefSeq Size 5304 bp
RefSeq ORF 1530 bp
Locus ID 57570
UniProt ID Q32P41
Cytogenetics 14q23.1
MW 58.3 kDa
Summary tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 PubMed 15248782).supplied by OMIM, Mar 2008
Transcript Variant: This variant (3) uses an alternate 5' terminal exon, resulting in a different 5' UTR and the use of an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, and is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020810" in other vectors (6)
SKU Description Size Price
RC210671 TRMT5 (Myc-DDK-tagged)-Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5) 10 ug
$474.00
RC210671L1 Lenti ORF clone of Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5), Myc-DDK-tagged 10 ug
$774.00
RC210671L2 Lenti ORF clone of Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5), mGFP tagged 10 ug
$774.00
RC210671L3 Lenti ORF clone of Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5), Myc-DDK-tagged 10 ug
$774.00
RC210671L4 Lenti ORF clone of Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5), mGFP tagged 10 ug
$774.00
RG210671 TRMT5 (tGFP-tagged) - Human TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5) 10 ug
$489.00 $674.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products