OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ANKRD2 (NM_020349) Human Untagged Clone

Be the first to review this product
SKU
SC304745
ANKRD2 (untagged)-Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA344170 Rabbit Polyclonal Anti-ANKRD2 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ANKRD2 or NM_020349"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ANKRD2
Synonyms ARPP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304745 representing NM_020349.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAAGGCGCCCAGCTGGGCAGGGGTGGGTGCTCTGGCCTATAAAGCCCCCGAGGCCCTGTGGCCT
GCAGAGGCGGTTATGGACGGCACCATGGAGGACTCCGAGGCGGTGCAGAGGGCCACAGCGCTCATCGAG
CAGCGGCTGGCACAGGAGGAGGAGAATGAGAAACTCCGAGGAGACGCACGCCAGAAGCTGCCCATGGAC
TTGCTGGTGCTGGAGGATGAGAAGCACCACGGGGCTCAGAGTGCAGCCCTGCAGAAGGTGAAGGGCCAA
GAGCGCGTGCGCAAGACGTCCCTGGACCTGCGGCGGGAGATCATCGATGTGGGCGGGATCCAGAACCTC
ATCGAGCTGCGGAAGAAACGCAAGCAGAAGAAGCGGGACGCTCTGGCCGCCTCGCATGAGCCGCCCCCA
GAGCCCGAGGAGATCACTGGCCCTGTGGATGAGGAGACCTTCCTGAAAGCTGCGGTGGAGGGGAAAATG
AAGGTCATTGAGAAGTTCCTGGCTGACGGGGGGTCAGCCGACACGTGCGACCAGTTCCGTCGGACAGCA
CTGCACCGAGCTTCCCTGGAAGGCCACATGGAAATCCTGGAGAAGCTTCTAGATAATGGGGCCACTGTG
GACTTCCAGGATCGGCTGGACTGCACAGCCATGCATTGGGCCTGCCGCGGGGGCCACTTAGAGGTGGTG
AAACTTCTGCAAAGCCATGGAGCAGACACCAATGTGAGGGATAAGCTGCTGAGCACCCCGCTGCACGTG
GCAGTCCGGACAGGGCAGGTGGAGATTGTGGAGCACTTTCTATCCCTGGGCCTGGAAATCAATGCCAGA
GACAGGGAAGGGGATACTGCCCTGCATGACGCTGTGAGGCTCAACCGCTACAAAATCATCAAACTGCTG
CTCCTGCATGGGGCTGACATGATGACCAAGAACCTGGCAGGAAAGACCCCGACGGACCTGGTGCAGCTC
TGGCAGGCTGATACCCGGCACGCCCTGGAGCATCCTGAGCCGGGGGCTGAGCATAACGGGCTGGAGGGG
CCTAATGATAGTGGGCGAGAGACCCCTCAGCCTGTGCCAGCCCAGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_020349
Insert Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020349.3
RefSeq Size 1520 bp
RefSeq ORF 1083 bp
Locus ID 26287
UniProt ID Q9GZV1
Cytogenetics 10q24.2
MW 39.9 kDa
Summary This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Mar 2014
Transcript Variant: This variant (1) represents the use of a downstream in-frame start codon compared to the AUG used in the transcript that produces isoform c. The encoded isoform (a, also known as M-Ankrd2) has a shorter N-terminus compared to isoform c.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020349" in other vectors (5)
SKU Description Size Price
RC210468 ANKRD2 (Myc-DDK-tagged)-Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1 10 ug
$457.00
RC210468L3 Lenti ORF clone of Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC210468L4 Lenti ORF clone of Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1, mGFP tagged 10 ug
$757.00
RG210468 ANKRD2 (tGFP-tagged) - Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1 10 ug
$489.00 $657.00
SC321026 ANKRD2 (untagged)-Human ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), transcript variant 1 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products