OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SIM2 (NM_009586) Human Untagged Clone

Be the first to review this product
SKU
SC303922
SIM2 (untagged)-Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s
  $532.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA381498 SIM2 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SIM2 or NM_009586"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SIM2
Synonyms bHLHe15; HMC13F06; HMC29C01; SIM
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_009586 edited
GCGATGAAGGAGAAGTCCAAGAATGCGGCCAAGACCAGGAGGGAGAAGGAAAATGGCGAG
TTTTACGAGCTTGCCAAGCTGCTCCCGCTGCCGTCGGCCATCACTTCGCAGCTGGACAAA
GCGTCCATCATCCGCCTCACCACGAGCTACCTGAAGATGCGCGCCGTCTTCCCCGAAGGT
TTAGGAGACGCGTGGGGACAGCCGAGCCGCGCCGGGCCCCTGGACGGCGTCGCCAAGGAG
CTGGGATCGCACTTGCTGCAGACTTTGGATGGATTTGTTTTTGTGGTAGCATCTGATGGC
AAAATCATGTATATATCCGAGACCGCTTCTGTCCATTTAGGCTTATCCCAGGTGGAGCTC
ACGGGCAACAGTATTTATGAATACATCCATCCTTCTGACCACGATGAGATGACCGCTGTC
CTCACGGCCCACCAGCCGCTGCACCACCACCTGCTCCAAGAGTATGAGATAGAGAGGTCG
TTCTTTCTTCGAATGAAATGTGTCTTGGCGAAAAGGAACGCGGGCCTGACCTGCAGCGGA
TACAAGGTCATCCACTGCAGTGGCTACTTGAAGATCAGGCAGTATATGCTGGACATGTCC
CTGTACGACTCCTGCTACCAGATTGTGGGGCTGGTGGCCGTGGGCCAGTCGCTGCCACCC
AGTGCCATCACCGAGATCAAGCTGTACAGTAACATGTTCATGTTCAGGGCCAGCCTTGAC
CTGAAGCTGATATTCCTGGATTCCAGGGTGACCGAGGTGACGGGTTACGAGCCGCAGGAC
CTGATCGAGAAGACCCTATACCATCACGTGCACGGCTGCGACGTGTTCCACCTCCGCTAC
GCACACCACCTCCTGTTGGTGAAGGGCCAGGTCACCACCAAGTACTACCGGCTGCTGTCC
AAGCGGGGCGGCTGGGTGTGGGTGCAGAGCTACGCCACCGTGGTGCACAACAGCCGCTCG
TCCCGGCCCCACTGCATCGTGAGTGTCAATTATGTACTCACGGAGATTGAATACAAGGAA
CTTCAGCTGTCCCTGGAGCAGGTGTCCACTGCCAAGTCCCAGGACTCCTGGAGGACCGCC
TTGTCTACCTCACAAGAAACTAGGAAATTAGTGAAACCCAAAAATACCAAGATGAAGACA
AAGCTGAGAACAAACCCTTACCCCCCACAGCAATACAGCTCGTTCCAAATGGACAAACTG
GAATGCGGCCAGCTCGGAAACTGGAGAGCCAGTCCCCCTGCAAGCGCTGCTGCTCCTCCA
GAACTGCAGCCCCACTCAGAAAGCAGTGACCTTCTGTACACGCCATCCTACAGCCTGCCC
TTCTCCTACCATTACGGACACTTCCCTCTGGACTCTCACGTCTTCAGCAGCAAAAAGCCA
ATGTTGCCGGCCAAGTTCGGGCAGCCCCAAGGATCCCCTTGTGAGGTGGCACGCTTTTTC
CTGAGCACACTGCCAGCCAGCGGTGAATGCCAGTGGCATTATGCCAACCCCCTAGTGCCT
AGCAGCTCGTCTCCAGCTAAAAATCCTCCAGAGCCACCGGCGAACACTGCTAGGCACAGC
CTGGTGCCAAGCTACGAAGGTGGGTCAGGTCTGCTCGTGGGGAAGGTGGGAGGACTGCGC
ACGGCCGGGAGCCGAAGCAGCCATGGCGGTGGGTGGCAGATGGAGACAGAACCCTCACGC
TTTGGGCAAACTTGCCCTCTTTCTGCTTCTAAGTAGGGCTTGCTGTGCTTTCTTGCTCT
Restriction Sites Please inquire |
ACCN NM_009586
Insert Size 1800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_009586.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009586.1, NP_033664.1
RefSeq Size 2823 bp
RefSeq ORF 1713 bp
Locus ID 6493
UniProt ID Q14190
Cytogenetics 21q22.13
Protein Families Druggable Genome, Transcription Factors
Summary This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. provided by RefSeq, Sep 2014
Transcript Variant: This variant (SIM2s) contains alternate 3' exon structure, and it thus differs in the 3' coding region and 3' UTR, compared to variant SIM2. The encoded isoform (short) has a distinct C-terminus and is shorter than isoform long.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009586" in other vectors (6)
SKU Description Size Price
RC216257 SIM2 (Myc-DDK-tagged)-Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s 10 ug
$531.00
RC216257L1 Lenti ORF clone of Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s, Myc-DDK-tagged 10 ug
$831.00
RC216257L2 Lenti ORF clone of Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s, mGFP tagged 10 ug
$831.00
RC216257L3 Lenti ORF clone of Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s, Myc-DDK-tagged 10 ug
$831.00
RC216257L4 Lenti ORF clone of Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s, mGFP tagged 10 ug
$831.00
RG216257 SIM2 (tGFP-tagged) - Human single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2s 10 ug
$489.00 $731.00

file-alt Citations

Multiple roles of single-minded 2 in esophageal squamous cell carcinoma and its clinical implications
Tamaoki, Komatsuzaki, Komatsu et al
Cancer Sci. (2018) 109 (4), 1121-1134 DOI: 10.1111/cas.13531
AI Summary: OriGene products pCMV6-AC-GFP-SIM2, pCMV6-SIM2s, and pCMV6-neo were used to transfect cells with different SIM2 isoforms, enabling the study of SIM2's roles in tumor differentiation and chemoradiotherapy sensitivity in esophageal squamous cell carcinoma.
Snippet: pCMV6‐AC‐GFP containing the long isoform of the SIM2 cDNA and pCMV6‐neo containing SIM2s cDNA were purchased from OriGene Technologies (Rockville, MD, USA). Cells were plated at 2 × 106 per 10‐cm dish, and transfected with either pCMV6‐AC‐GFP‐SIM2 or pCMV6‐SIM2s or no insert of pCMV6‐neo (OriGene Technologies) by using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. … Colonies were transferred to larger plates, and expression of different splicing isoforms of SIM2 mRNAs was examined by quantitative real‐time PCR
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products