OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RFPL3 (NM_006604) Human Untagged Clone

Be the first to review this product
SKU
SC303798
RFPL3 (untagged)-Human ret finger protein-like 3 (RFPL3), transcript variant 2
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA504731 RFPL3 mouse monoclonal antibody, clone OTI2G4 (formerly 2G4) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RFPL3 or NM_006604"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RFPL3
Synonyms RNF120
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303798 representing NM_006604.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCACTCTTCCAAGAAGCAAGCAGCTGTCCCGTCTGCTCAGACTATCTGGAAAAACCAATGTCC
CTGGAGTGTGGATGCACCGTCTGCCTCAAGTGCATCAATTCGCTGCAGAAGGAGCCCCATGGGGAGGAT
CTGCTTTGCTGTTGCTGTTCCATGGTCTCTCAGAGGAACAAAATCAGGCCCAATCGGCAGCTAGAGAGG
CTGGTTTCCCACATCAAGGAACTGGAGCCCAAGCTGAAGAAGATTCTACAGATGAACCCAAGGATGCGG
AAGTTCCAAGTGGATATGACCTTGGATGCCGACACAGCCAACAACTTCCTCCTCATTTCTGACGACCTC
AGGAGCGTCCGAAGTGGGCTCATCACACAGAATCGGCAAGACCTTGCCGAGAGATTTGACGTGTCCGTT
TGCATCCTGGGCTCCCCTCGCTTTACCTGTGGCCGCCACTACTGGGAGGTGGACGTGGGAACAAGCACA
GAATGGGACCTGGGAGTCTGCAGAGAATCTGTTCACTGCAAAGGGAAGATCCAGCTGACCACAGAGCTT
GGATTCTGGACTGTGAGTTTGAGGGATGGAAGCCGCCTCTCTGCCAGCACGGTGCCGCTGACTTTCCTC
TTAGTAGACCGCAAGTTACAGCGAGTGGGGATTTTTCTGGATATGGGCATGCAGAACGTTTCCTTTTTT
GATGCTGAAAGTGGTTCCCATGTCTATACATTCAGGAGCGTCTCTGCTGAGGAGCCACTGCGCCCATTT
TTGGCTCCTTCAATTCCACCTAATGGTGATCAAGGTGTCTTGAGCATCTGTCCTTTGATGAACTCAGGC
ACTACTGATGCTCCAGTCCGTCCTGGGGAGGCCAAATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_006604
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006604.2
RefSeq Size 1214 bp
RefSeq ORF 867 bp
Locus ID 10738
UniProt ID O75679
Cytogenetics 22q12.3
Protein Families Druggable Genome
MW 32.2 kDa
Summary (Microbial infection) Stimulates the activity of Human Immunodeficiency Virus 1/HIV-1 pre-integration complex.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) contains an alternate 5' exon and differs in the 5' UTR, compared to variant 1. These differences cause translation initiation at a downstream AUG and an isoform (2) with a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006604" in other vectors (4)
SKU Description Size Price
RC206518 RFPL3 (Myc-DDK-tagged)-Human ret finger protein-like 3 (RFPL3), transcript variant 2 10 ug
$300.00
RC206518L3 Lenti ORF clone of Human ret finger protein-like 3 (RFPL3), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC206518L4 Lenti ORF clone of Human ret finger protein-like 3 (RFPL3), transcript variant 2, mGFP tagged 10 ug
$600.00
RG206518 RFPL3 (tGFP-tagged) - Human ret finger protein-like 3 (RFPL3), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products