OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BOB1 (POU2AF1) (NM_006235) Human Untagged Clone

Be the first to review this product
SKU
SC303755
POU2AF1 (untagged)-Human POU class 2 associating factor 1 (POU2AF1)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA807930 POU2AF1 mouse monoclonal antibody, clone OTI2D3 (formerly 2D3) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BOB1 or NM_006235"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BOB1
Synonyms BOB1; OBF-1; OBF1; OCAB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006235, the custom clone sequence may differ by one or more nucleotides


ATGCTCTGGCAAAAACCCACAGCTCCGGAGCAAGCCCCAGCCCCGGCCCGGCCATACCAGGGCGTCCGTG
TGAAGGAGCCAGTGAAGGAACTGCTGAGGAGGAAGCGAGGCCACGCCAGCAGTGGGGCAGCACCTGCACC
TACGGCGGTGGTGCTGCCCCATCAGCCCCTGGCGACCTACACCACAGTGGGTCCTTCCTGCCTGGACATG
GAAGGTTCTGTGTCTGCAGTGACAGAGGAGGCTGCCCTGTGTGCCGGCTGGCTCTCCCAGCCCACCCCGG
CCACCCTGCAGCCCCTGGCCCCATGGACACCTTACACCGAGTATGTGCCCCATGAAGCTGTCAGCTGCCC
CTACTCAGCTGACATGTATGTGCAGCCCGTGTGCCCCAGCTACACGGTGGTGGGGCCCTCCTCAGTGTTG
ACCTATGCCTCTCCGCCACTCATCACCAATGTCACGACAAGAAGCTCCGCCACGCCCGCAGTGGGGCCCC
CGCTGGAGGGCCCAGAGCACCAGGCACCCCTCACCTATTTCCCGTGGCCTCAGCCCCTTTCCACACTACC
CACCTCCACCCTGCAGTACCAGCCTCCGGCCCCAGCCCTACCTGGGCCCCAGTTTGTCCAGCTCCCCATC
TCTATCCCAGAGCCAGTCCTTCAGGACATGGAAGACCCCAGAAGAGCCGCCAGCTCGTTGACCATCGACA
AGCTGCTTTTGGAGGAAGAGGATAGCGACGCCTATGCGCTTAACCACACTCTCTCTGTGGAAGGCTTTTA
G
Restriction Sites Please inquire |
ACCN NM_006235
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006235.1, NP_006226.1
RefSeq Size 3314 bp
RefSeq ORF 771 bp
Locus ID 5450
UniProt ID Q16633
Cytogenetics 11q23.1
Summary Transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006235" in other vectors (4)
SKU Description Size Price
RC207562 POU2AF1 (Myc-DDK-tagged)-Human POU class 2 associating factor 1 (POU2AF1) 10 ug
$300.00
RC207562L3 Lenti ORF clone of Human POU class 2 associating factor 1 (POU2AF1), Myc-DDK-tagged 10 ug
$600.00
RC207562L4 Lenti ORF clone of Human POU class 2 associating factor 1 (POU2AF1), mGFP tagged 10 ug
$600.00
RG207562 POU2AF1 (tGFP-tagged) - Human POU class 2 associating factor 1 (POU2AF1) 10 ug
$489.00 $500.00

file-alt Citations

Regulation of normal B-cell differentiation and malignant B-cell survival by OCT2
Hodson, Shaffer, Xiao et al
PNAS (2016)
Cited by 115
AI Summary: OriGene’s OCA-B cDNA product was used in this study to investigate the role of OCA-B in B-cell differentiation and lymphoma survival by enabling the expression and functional analysis of OCA-B in relevant experimental systems.
Snippet: Plasmids. OCT2 was cloned from cDNA from the BJAB cell line, and OCA-B cDNA was purchased from OriGene. Both were cloned into the vectors pCMV-TOP and pFlagBiopCMV-TOP (30). Site-directed mutations were introduced using the QuikChange Lightning kit from Agilent. shRNAs targeting OCT2 or OCA-B were designed and cloned as double-stranded oligonucleotides into a retroviral vector (pRSMX_PuroGFP) for ...
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products