OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

KRT33A (NM_004138) Human Untagged Clone

Be the first to review this product
SKU
SC303439
KRT33A (untagged)-Human keratin 33A (KRT33A)
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA358987 KRT33A Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "KRT33A or NM_004138"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KRT33A
Synonyms Ha-3I; HA3I; hHa3-I; K33A; Krt1-3; KRTHA3A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303439 representing NM_004138.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTTACAGTTGTGGCCTGCCCAGCCTGAGCTGCCGCACCAGCTGCTCCTCCCGGCCCTGTGTGCCC
CCCAGCTGCCACGGCTGCACCCTGCCCGGGGCCTGCAACATCCCCGCCAATGTGAGCAACTGCAACTGG
TTCTGTGAGGGCTCCTTCAATGGCAGTGAGAAGGAGACCATGCAGTTCCTGAACGACCGCCTGGCCAGC
TACCTGGAGAAGGTGCGTCAGCTGGAGCGGGACAACGCGGAGCTGGAGAACCTCATCCGGGAGCGGTCA
CAGCAGCAGGAGCCCTTGGTGTGTGCCAGCTACCAGTCCTACTTCAAGACCATTGAGGAGCTCCAGCAG
AAGATCCTGTGCAGCAAGTCTGAGAATGCCAGGCTTGTGGTGCAGATCGACAATGCCAAGCTGGCCTCA
GATGACTTCAGGACCAAATATGAGACCGAGCTGTCCCTGCGGCAGCTGGTGGAGTCGGACATCAATGGC
CTGCGCAGGATCCTGGATGAGCTGACCCTGTGCAGGTCTGACCTGGAGGCCCAGGTGGAGTCCCTGAAG
GAGGAGCTGCTGTGCCTCAAGCAGAACCATGAGCAGGAGGTTAACACCCTGCGCTGCCAGCTTGGAGAC
CGCCTCAACGTGGAGGTGGACGCTGCTCCCACTGTGGACCTGAACCAGGTCCTGAATGAGACCAGGAGT
CAGTATGAGGCCCTGGTGGAAACCAACCGCAGGGAAGTGGAGCAATGGTTCGCCACGCAGACCGAGGAG
CTGAACAAGCAGGTGGTATCCAGCTCGGAGCAGCTGCAGTCCTACCAGGCGGAGATCATCGAGCTGAGA
CGCACGGTCAATGCCCTGGAGATCGAGCTGCAGGCCCAGCACAACCTGCGAGACTCTCTGGAAAACACG
CTGACAGAGAGCGAGGCCCGCTACAGCTCCCAGCTGTCCCAGGTGCAGAGACTGATCACCAACGTGGAG
TCCCAGCTGGCGGAGATCCGCAGTGACCTGGAGCGGCAGAACCAGGAGTATCAGGTGCTGCTGGACGTG
CGGGCGCGGCTGGAGTGTGAGATCAACACGTACCGGAGCCTGCTGGAGAGCGAGGACTGCAAGCTCCCC
TCCAACCCCTGCGCCACAACCAATGCATGTGACAAGTCCACTGGGCCCTGTATCTCTAATCCCTGTGGC
CTACGTGCTCGGTGTGGGCCTTGCAACACATTTGGGTACTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_004138
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004138.3
RefSeq Size 1287 bp
RefSeq ORF 1215 bp
Locus ID 3883
UniProt ID O76009
Cytogenetics 17q21.2
MW 45.9 kDa
Summary This gene encodes a member of the keratin gene family. This gene is one of multiple type I hair keratin genes that are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. As a type I hair keratin, the encoded protein is an acidic protein which heterodimerizes with type II keratins to form hair and nails. There are two isoforms of this protein, encoded by two separate genes, keratin 33A and keratin 33B. provided by RefSeq, May 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004138" in other vectors (4)
SKU Description Size Price
RC214177 KRT33A (Myc-DDK-tagged)-Human keratin 33A (KRT33A) 10 ug
$457.00
RC214177L3 Lenti ORF clone of Human keratin 33A (KRT33A), Myc-DDK-tagged 10 ug
$757.00
RC214177L4 Lenti ORF clone of Human keratin 33A (KRT33A), mGFP tagged 10 ug
$757.00
RG214177 KRT33A (tGFP-tagged) - Human keratin 33A (KRT33A) 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products