OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HMGA2 (NM_003483) Human Untagged Clone

Be the first to review this product
SKU
SC303313
HMGA2 (untagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA308757 Rabbit polyclonal antibody to HMGA2 (high mobility group AT-hook 2)
100 ul
$665.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HMGA2 or NM_003483"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HMGA2
Synonyms BABL; HMGI-C; HMGIC; LIPO; SRS5; STQTL9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003483 edited
CGGGAGGCAGGATGAGCGCACGCGGTGAGGGCGCGGGGCAGCCGTCCACTTCAGCCCAGG
GACAACCTGCCGCCCCAGCGCCTCAGAAGAGAGGACGCGGCCGCCCCAGGAAGCAGCAGC
AAGAACCAACCGGTGAGCCCTCTCCTAAGAGACCCAGGGGAAGACCCAAAGGCAGCAAAA
ACAAGAGTCCCTCTAAAGCAGCTCAAAAGAAAGCAGAAGCCACTGGAGAAAAACGGCCAA
GAGGCAGACCTAGGAAATGGCCACAACAAGTTGTTCAGAAGAAGCCTGCTCAGGAGGAAA
CTGAAGAGACATCCTCACAAGAGTCTGCCGAAGAGGACTAG
Restriction Sites Please inquire |
ACCN NM_003483
Insert Size 340 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003483.4.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003483.4, NP_003474.1
RefSeq Size 4150 bp
RefSeq ORF 330 bp
Locus ID 8091
UniProt ID P52926
Cytogenetics 12q14.3
Protein Families Druggable Genome
Summary This gene encodes a protein that belongs to the non-histone chromosomal high mobility group (HMG) protein family. HMG proteins function as architectural factors and are essential components of the enhancesome. This protein contains structural DNA-binding domains and may act as a transcriptional regulating factor. Identification of the deletion, amplification, and rearrangement of this gene that are associated with myxoid liposarcoma suggests a role in adipogenesis and mesenchymal differentiation. A gene knock out study of the mouse counterpart demonstrated that this gene is involved in diet-induced obesity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003483" in other vectors (6)
SKU Description Size Price
RC214629 HMGA2 (Myc-DDK-tagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 1 10 ug
$150.00
RC214629L1 Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC214629L2 Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, mGFP tagged 10 ug
$450.00
RC214629L3 Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC214629L4 Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG214629 HMGA2 (tGFP-tagged) - Human high mobility group AT-hook 2 (HMGA2), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products