OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PDE7A (NM_002603) Human Untagged Clone

Be the first to review this product
SKU
SC303225
PDE7A (untagged)-Human phosphodiesterase 7A (PDE7A), transcript variant 1
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA338280 Rabbit Polyclonal Anti-PDE7A Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PDE7A or NM_002603"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PDE7A
Synonyms HCP1; PDE7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002603 edited
TTGGAAGGCAGCTGCTTGAGGTCCAAGGCAGTCAGTGTCCCCTCTCTTTTGCCTCGGGAC
AGCTGGTATTTATCAGACTCCTAAGAAGTTTTCCTTGCTCCCTAGTAGAAGAGAGAGATT
ATGCAGCGGGCTTTTGATTGATCCAATGGGAATTACATTGATCTGGTGTCTGGCCTTGGT
TCTTATCAAGTGGATCACCTCTAAGAGGCGTGGAGCTATTTCCTATGACAGTTCTGATCA
GACTGCATTATACATTCGTATGCTAGGAGATGTACGTGTAAGGAGCCGAGCAGGATTTGA
ATCAGAAAGAAGAGGTTCTCACCCATATATTGATTTTCGTATTTTCCACTCTCAATCTGA
AATTGAAGTGTCTGTCTCTGCAAGGAATATCAGAAGGCTACTAAGTTTCCAGCGATATCT
TAGATCTTCACGCTTTTTTCGTGGTACTGCGGTTTCAAATTCCCTAAACATTTTAGATGA
TGATTATAATGGACAAGCCAAGTGTATGCTGGAAAAAGTTGGAAATTGGAATTTTGATAT
CTTTCTATTTGATAGACTAACAAATGGAAATAGTCTAGTAAGCTTAACCTTTCATTTATT
TAGTCTTCATGGATTAATTGAGTACTTCCATTTAGATATGATGAAACTTCGTAGATTTTT
AGTTATGATTCAAGAAGATTACCACAGTCAAAATCCTTACCATAACGCAGTCCACGCTGC
GGATGTTACTCAGGCCATGCACTGTTACTTAAAGGAACCTAAGCTTGCCAATTCTGTAAC
TCCTTGGGATATCTTGCTGAGCTTAATTGCAGCTGCCACTCATGATCTGGATCATCCAGG
TGTTAATCAACCTTTCCTTATTAAAACTAACCATTACTTGGCAACTTTATACAAGAATAC
CTCAGTACTGGAAAATCACCACTGGAGATCTGCAGTGGGCTTATTGAGAGAATCAGGCTT
ATTCTCACATCTGCCATTAGAAAGCAGGCAACAAATGGAGACACAGATAGGTGCTCTGAT
ACTAGCCACAGACATCAGTCGCCAGAATGAGTATCTGTCTTTGTTTAGGTCCCATTTGGA
TAGAGGTGATTTATGCCTAGAAGACACCAGACACAGACATTTGGTTTTACAGATGGCTTT
GAAATGTGCTGATATTTGTAACCCATGTCGGACGTGGGAATTAAGCAAGCAGTGGAGTGA
AAAAGTAACGGAGGAATTCTTCCATCAAGGAGATATAGAAAAAAAATATCATTTGGGTGT
GAGTCCACTTTGCGATCGTCACACTGAATCTATTGCCAACATCCAGATTGGTTTTATGAC
TTACCTAGTGGAGCCTTTATTTACAGAATGGGCCAGGTTTTCCAATACAAGGCTATCCCA
GACAATGCTTGGACACGTGGGGCTGAATAAAGCCAGCTGGAAGGGACTGCAGAGAGAACA
GTCGAGCAGTGAGGACACTGATGCTGCATTTGAGTTGAACTCACAGTTATTACCTCAGGA
AAATCGGTTATCATAACCCCCAGAACCAGTGGGACAAACTGCCTCCTGGAGGTTTTTAGA
AATGTGAAATGGGGTCTTGAGGTGAGAGAACTTAACTCTTGACTGCCAAGGTTTCCAAGT
GAGTGATGCCAGCCAGCATTATTTATTTCCAAGATTTCCTCTGTTGGATCATTTGAACCC
ACTTGTTAATTGCAAGACCCGAACATACAGCAATATGAATTTGGCTTT
Restriction Sites Please inquire |
ACCN NM_002603
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002603.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002603.1, NP_002594.1
RefSeq Size 1739 bp
RefSeq ORF 1371 bp
Locus ID 5150
UniProt ID Q13946
Cytogenetics 8q13.1
Protein Families Druggable Genome
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
Summary The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. provided by RefSeq, Jul 2011
Transcript Variant: This variant (1, also called PDE7A2) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (a) has a distinct N-terminus compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002603" in other vectors (6)
SKU Description Size Price
RC214749 PDE7A (Myc-DDK-tagged)-Human phosphodiesterase 7A (PDE7A), transcript variant 1 10 ug
$457.00
RC214749L1 Lenti ORF clone of Human phosphodiesterase 7A (PDE7A), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC214749L2 Lenti ORF clone of Human phosphodiesterase 7A (PDE7A), transcript variant 1, mGFP tagged 10 ug
$757.00
RC214749L3 Lenti ORF clone of Human phosphodiesterase 7A (PDE7A), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC214749L4 Lenti ORF clone of Human phosphodiesterase 7A (PDE7A), transcript variant 1, mGFP tagged 10 ug
$757.00
RG214749 PDE7A (tGFP-tagged) - Human phosphodiesterase 7A (PDE7A), transcript variant 1 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products