OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

KRT31 (NM_002277) Human Untagged Clone

Be the first to review this product
SKU
SC303162
KRT31 (untagged)-Human keratin 31 (KRT31)
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811097 KRT31 mouse monoclonal antibody,clone OTI2C3 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "KRT31 or NM_002277"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KRT31
Synonyms Ha-1; HA1; hHa1; KRTHA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303162 representing NM_002277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCTACAACTTCTGCCTGCCCAGCCTGAGCTGCCGCACCAGCTGCTCCTCCCGGCCCTGCGTGCCC
CCCAGCTGCCACAGCTGCACCCTGCCCGGGGCCTGCAACATCCCCGCCAATGTGAGCAACTGCAACTGG
TTCTGCGAGGGCTCCTTCAATGGTAGCGAGAAGGAGACTATGCAGTTCCTGAACGACCGCCTGGCCAGC
TACCTGGAGAAAGTGCGTCAGCTGGAGCGGGACAACGCGGAGCTGGAGAACCTCATCCGGGAGCGGTCT
CAGCAGCAGGAGCCCTTGCTGTGCCCCAGTTACCAGTCCTATTTTAAGACCATTGAGGAGCTCCAGCAG
AAGATCCTGTGTACCAAGTCTGAGAATGCCAGGCTTGTGGTGCAGATCGACAACGCCAAGCTGGCTGCG
GATGATTTCAGAACCAAGTACCAGACCGAGCTGTCCCTGCGGCAGCTGGTGGAGTCGGACATCAACGGT
CTGCGCAGGATCCTGGATGAGCTGACCCTGTGCAAGTCCGACCTGGAGGCCCAGGTGGAGTCCCTGAAG
GAGGAGCTGCTCTGCCTCAAGAGCAACCATGAGCAGGAGGTCAATACCCTGCGCTGCCAGCTTGGAGAC
CGCCTCAATGTGGAGGTGGATGCTGCTCCCACTGTGGACCTGAATCGGGTGCTGAACGAGACCAGGAGT
CAGTATGAGGCCCTGGTGGAAACCAACCGCAGGGAAGTGGAGCAATGGTTCACCACGCAGACCGAGGAG
CTGAACAAGCAGGTGGTATCCAGCTCAGAGCAGCTGCAGTCCTACCAGGCGGAGATCATCGAGCTGAGA
CGCACAGTCAACGCCCTGGAGATCGAGCTGCAGGCCCAGCACAACCTGCGAGACTCTCTGGAAAACACG
CTGACAGAGAGTGAGGCCCGCTACAGCTCCCAGCTGTCCCAGGTGCAGAGCCTGATCACCAACGTGGAG
TCCCAGCTGGCGGAGATCCGCAGTGACCTGGAGCGGCAGAACCAGGAGTACCAGGTGCTGCTGGATGTG
CGTGCCCGGCTGGAGTGTGAGATCAACACATACCGGAGCCTGCTGGAGAGCGAGGACTGCAATCTGCCC
AGCAATCCCTGTGCCACGACCAACGCGTGCAGCAAGCCCATCGGACCCTGTCTCTCCAATCCCTGTACC
TCTTGTGTCCCTCCTGCCCCCTGCACACCCTGTGCCCCACGCCCCCGCTGTGGGCCCTGCAATTCCTTC
GTGCGCTAG
AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII |
ACCN NM_002277
Insert Size 1251 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002277.2
RefSeq Size 1616 bp
RefSeq ORF 1251 bp
Locus ID 3881
UniProt ID Q15323
Cytogenetics 17q21.2
MW 47.2 kDa
Summary The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002277" in other vectors (4)
SKU Description Size Price
RC212623 KRT31 (Myc-DDK-tagged)-Human keratin 31 (KRT31) 10 ug
$457.00
RC212623L3 Lenti ORF clone of Human keratin 31 (KRT31), Myc-DDK-tagged 10 ug
$757.00
RC212623L4 Lenti ORF clone of Human keratin 31 (KRT31), mGFP tagged 10 ug
$757.00
RG212623 KRT31 (tGFP-tagged) - Human keratin 31 (KRT31) 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products