OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

WIPI2 (NM_001033520) Human Untagged Clone

Be the first to review this product
SKU
SC302717
WIPI2 (untagged)-Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 5
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA367805 WIPI2 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "WIPI2 or NM_001033520"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol WIPI2
Synonyms ATG18B; Atg21; CGI-50; IDDSSA; WIPI-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302717 representing NM_001033520.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCACGCATGTACTTCCCTTTGTGATTTCAGCCGATACGGAAGATGTGTGCATTGTAGAGAGATTG
TTCTCCAGCAGCCTAGTGGCCATCGTCAGCCTTAAAGCACCAAGGAAGCTAAAGGTTTGCCACTTTAAG
AAGGGAACTGAGATCTGCAACTACAGCTACTCCAACACGATTCTGGCTGTGAAGCTCAACAGGCAGAGG
CTGATAGTATGCCTGGAGGAGTCCCTGTACATCCACAACATTCGGGACATGAAGGTGCTGCATACGATC
AGGGAGACGCCTCCAAACCCTGCAGGCCTGTGTGCGCTGTCAATCAACAACGACAACTGCTACTTGGCG
TACCCAGGGAGCGCGACCATCGGAGAGGTGCAGGTCTTCGATACCATTAATTTGAGAGCTGCAAACATG
ATTCCGGCTCACGACAGTCCTTTAGCGGCACTGGCCTTTGACGCAAGTGGAACTAAACTTGCCACGGCT
TCGGAGAAGGGGACCGTGATTAGGGTATTTTCCATTCCAGAAGGACAAAAACTCTTTGAGTTTCGGAGA
GGAGTAAAGAGGTGCGTGAGCATCTGCTCCCTGGCCTTCAGCATGGACGGCATGTTCCTCTCCGCCTCC
AGCAACACTGAGACCGTGCACATCTTCAAACTCGAGACTGTGAAAGAAAAACCCCCAGAGGAGCCCACC
ACCTGGACCGGGTACTTCGGGAAAGTGCTCATGGCCTCCACCAGCTACCTGCCTTCCCAAGTGACAGAA
ATGTTCAACCAGGGCAGAGCCTTCGCCACGGTCCGCCTGCCATTCTGCGGCCACAAAAACATCTGCTCG
CTAGCCACAATTCAGAAGATCCCGCGGTTGTTGGTGGGTGCCGCCGACGGGTACCTGTACATGTACAAC
CTGGACCCCCAGGAGGGCGGCGAGTGTGCCCTGATGAAGCAGCACCGGCTGGACGGCAGTCTGGAAACG
ACCAATGAGATCTTGGACTCTGCCTCTCACGACTGCCCCTTAGTCACTCAGACATACGGCGCAGCTGCA
GGAAAAGCCTACACAGACGACCTGGGTGCTGTGGGTGGCGCCTGCCTGGAGGACGAGGCCAGCGCCCTG
CGCCTGGATGAGGACAGCGAGCACCCGCCCATGATTCTTCGGACTGACTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001033520
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033520.1
RefSeq Size 4295 bp
RefSeq ORF 1155 bp
Locus ID 26100
UniProt ID Q9Y4P8
Cytogenetics 7p22.1
MW 42.1 kDa
Summary WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins, such as WIPI2, have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al., 2004 PubMed 15602573).supplied by OMIM, Mar 2008
Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence and uses an alternate in-frame splice junction in a 3' exon compared to variant 1. The resulting isoform (e) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033520" in other vectors (4)
SKU Description Size Price
RC216506 WIPI2 (Myc-DDK-tagged)-Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 5 10 ug
$457.00
RC216506L3 Lenti-ORF clone of WIPI2 (Myc-DDK-tagged)-Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 5 10 ug
$757.00
RC216506L4 Lenti-ORF clone of WIPI2 (mGFP-tagged)-Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 5 10 ug
$757.00
RG216506 WIPI2 (tGFP-tagged) - Human WD repeat domain, phosphoinositide interacting 2 (WIPI2), transcript variant 5 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products