OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FBXO7 (NM_001033024) Human Untagged Clone

Be the first to review this product
SKU
SC302674
FBXO7 (untagged)-Human F-box protein 7 (FBXO7), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA329827 Rabbit Polyclonal Anti-FBXO7 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "FBXO7 or NM_001033024"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FBXO7
Synonyms FBX; FBX07; FBX7; PARK15; PKPS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302674 representing NM_001033024.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCGGCCTCCCGGGGGCTCTGGTCCCCTCCTCGATTCAGAGCATTCTTCACTCCAGAATAATGAG
CAACCCTCTTTGGCCACCAGCTCCAATCAGACTAGCATGCAGGATGAACAACCAAGTGATTCATTCCAA
GGACAGGCAGCCCAGTCTGGTGTTTGGAATGACGACAGTATGTTAGGGCCTAGTCAAAATTTTGAAGCT
GAGTCAATTCAAGATAATGCGCATATGGCAGAGGGCACAGGTTTCTATCCCTCAGAACCCATGCTCTGT
AGTGAATCGGTGGAAGGGCAAGTGCCACATTCATTAGAGACCTTGTATCAATCAGCTGACTGTTCTGAT
GCCAATGATGCCTTGATAGTGTTGATACATCTTCTCATGTTGGAGTCAGGTTACATACCTCAGGGCACC
GAAGCCAAAGCACTGTCCATGCCGGAGAAGTGGAAGTTGAGCGGGGTGTATAAGCTGCAGTACATGCAT
CCTCTCTGCGAGGGCAGCTCCGCTACTCTCACCTGTGTGCCTTTGGGAAACCTGATTGTTGTAAATGCT
ACACTAAAAATCAACAATGAGATTAGAAGTGTGAAAAGATTGCAGCTGCTACCAGAATCTTTTATTTGC
AAAGAGAAACTAGGGGAAAATGTAGCCAACATATACAAAGATCTTCAGAAACTCTCTCGCCTCTTTAAA
GACCAGCTGGTGTATCCTCTTCTGGCTTTTACCCGACAAGCACTGAACCTACCAGATGTATTTGGGTTG
GTCGTCCTCCCATTGGAACTGAAACTACGGATCTTCCGACTTCTGGATGTTCGTTCCGTCTTGTCTTTG
TCTGCGGTTTGTCGTGACCTCTTTACTGCTTCAAATGACCCACTCCTGTGGAGGTTTTTATATCTGCGT
GATTTTCGAGACAATACTGTCAGAGTTCAAGACACAGATTGGAAAGAACTGTACAGGAAGAGGCACATA
CAAAGAAAAGAATCCCCGAAAGGGCGGTTTGTGATGCTCCTGCCATCGTCAACTCACACCATTCCATTC
TATCCCAACCCCTTGCACCCTAGGCCATTTCCTAGCTCCCGCCTTCCTCCAGGAATTATCGGGGGTGAA
TATGACCAAAGACCAACACTTCCCTATGTTGGAGACCCAATCAGTTCACTCATTCCTGGTCCTGGGGAG
ACGCCCAGCCAGTTTCCTCCACTGAGACCACGCTTTGATCCAGTTGGCCCACTTCCAGGACCTAACCCC
ATCTTGCCAGGGCGAGGCGGCCCCAATGACAGATTTCCCTTTAGACCCAGCAGGGGTCGGCCAACTGAT
GGCCGGCTGTCATTCATGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001033024
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033024.1
RefSeq Size 1758 bp
RefSeq ORF 1332 bp
Locus ID 25793
UniProt ID Q9Y3I1
Cytogenetics 22q12.3
Protein Families Druggable Genome
MW 49.4 kDa
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) contains a different 5' UTR and 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2) with a distinct N- terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033024" in other vectors (4)
SKU Description Size Price
RC218979 FBXO7 (Myc-DDK-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 10 ug
$457.00
RC218979L3 Lenti-ORF clone of FBXO7 (Myc-DDK-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 10 ug
$757.00
RC218979L4 Lenti-ORF clone of FBXO7 (mGFP-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 10 ug
$757.00
RG218979 FBXO7 (tGFP-tagged) - Human F-box protein 7 (FBXO7), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products