OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

APRT (NM_001030018) Human Untagged Clone

Be the first to review this product
SKU
SC302495
APRT (untagged)-Human adenine phosphoribosyltransferase (APRT), transcript variant 2
  $165.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA324753 APRT Antibody (N-term)
400 ul
$645.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "APRT or NM_001030018"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol APRT
Synonyms AMP; APRTD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302495 representing NM_001030018.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCCCCGACTTCCCCACCCCAGGC
GTGGTATTCAGGGACATCTCGCCCGTCCTGAAGGACCCCGCCTCCTTCCGCGCCGCCATCGGCCTCCTG
GCGCGACACCTGAAGGCGACCCACGGGGGCCGCATCGACTACATCGCAGGCCTAGACTCCCGAGGCTTC
CTCTTTGGCCCCTCCCTGGCCCAGGAGCTTGGACTGGGCTGCGTGCTCATCCGAAAGCGGGGGAAGCTG
CCAGGCCCCACTCTGTGGGCCTCCTATTCCCTGGAGTACGGGAAGGCTGAGCTGGAGATTCAGAAAGAC
GCCCTGGAGCCAGGACAGAGGGTGGTCGTCGTGGATGATCTGCTGGCCACTGGTGTATGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001030018
Insert Size 405 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001030018.1
RefSeq Size 673 bp
RefSeq ORF 405 bp
Locus ID 353
UniProt ID P07741
Cytogenetics 16q24.3
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
MW 14.6 kDa
Summary Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) lacks an alternate segment compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001030018" in other vectors (4)
SKU Description Size Price
RC222337 APRT (Myc-DDK-tagged)-Human adenine phosphoribosyltransferase (APRT), transcript variant 2 10 ug
$150.00
RC222337L3 Lenti ORF clone of Human adenine phosphoribosyltransferase (APRT), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC222337L4 Lenti ORF clone of Human adenine phosphoribosyltransferase (APRT), transcript variant 2, mGFP tagged 10 ug
$450.00
RG222337 APRT (tGFP-tagged) - Human adenine phosphoribosyltransferase (APRT), transcript variant 2 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products