OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PGAM4 (NM_001029891) Human Untagged Clone

Be the first to review this product
SKU
SC302465
PGAM4 (untagged)-Human phosphoglycerate mutase family member 4 (PGAM4)
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA810871 PGAM4 mouse monoclonal antibody,clone OTI2A12 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PGAM4 or NM_001029891"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PGAM4
Synonyms dJ1000K24.1; PGAM-B; PGAM1; PGAM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302465 representing NM_001029891.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCACATGGAACCTGGAGAACCGCTTCAGC
TGCTGGTACGACGCCGATCTGAGCCCGGCGGGCCACGAGGAGGCGAAGCGCGGCGGGCAGGCGCTACGA
GATGCTGGCTATGAGTTTGACATCTGCCTCACCTCAGTGCAGAAGAGAGTGATCCGGACCCTCTGGACA
GTGCTAGATGCCATTGATCAGATGTGGCTGCCAGTGGTGAGGACTTGGCGCCTCAATGAGCGGCACTAT
GGGGGTCTAACCGGTCTCAATAAAGCAGAAACTGCTGCAAAGCATGGTGAGGCCCAGGTGAAGATCTGG
AGGCGCTCCTATGATGTCCCACCACCTCCGATGGAGCCCGACCATCCTTTCTACAGCAACATCAGTAAG
GATCGCAGGTATGCAGACCTCACAGAAGATCAGCTACCCTCCTATGAGAGTCCGAAGGATACTATTGCC
AGAGCTCTGCCCTTCTGGAATGAAGAAATAGTTCCCCAGATCAAGGAGGGGAAACGTGTACTGATTGCA
GCCCATGGCAACAGCCTCCAGGGCATTGCCAAGCATGTGGAGGGTCTCTCTGAAGAGGCTATCATGGAG
CTGAACCTGCCGACTGGTATTCCCATCGTCTATGAATTGGACAAGAACTTGAAGCCTATCAAGCCCATG
CAGTTTCTGGGGGATGAAGAGACGGTGTGCAAAGCCATAGAAGCTGTGGCTGCCCAGGGCAAGGCCAAG
AAGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001029891
Insert Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001029891.2
RefSeq Size 1678 bp
RefSeq ORF 765 bp
Locus ID 441531
UniProt ID Q8N0Y7
Cytogenetics Xq21.1
Protein Pathways Glycolysis / Gluconeogenesis, Metabolic pathways
MW 28.8 kDa
Summary This intronless gene appears to have arisen from a retrotransposition event, yet it is thought to be an expressed, protein-coding gene. The encoded protein is a member of the phosphoglycerate mutase family, a set of enzymes that catalyze the transfer of a phosphate group from 3-phosphoglycerate to 2-phosphoglycerate. provided by RefSeq, May 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001029891" in other vectors (4)
SKU Description Size Price
RC213480 PGAM4 (Myc-DDK-tagged)-Human phosphoglycerate mutase family member 4 (PGAM4) 10 ug
$300.00
RC213480L3 Lenti ORF clone of Human phosphoglycerate mutase family member 4 (PGAM4), Myc-DDK-tagged 10 ug
$600.00
RC213480L4 Lenti ORF clone of Human phosphoglycerate mutase family member 4 (PGAM4), mGFP tagged 10 ug
$600.00
RG213480 PGAM4 (tGFP-tagged) - Human phosphoglycerate mutase family member 4 (PGAM4) 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products