MTCP1 (NM_001018025) Human Untagged Clone

SKU SC302131

MTCP1 (untagged)-Human mature T-cell proliferation 1 (MTCP1), nuclear gene encoding mitochondrial protein

Product Data

• Type: Human Untagged Clone
• Target Symbol: MTCP1
• Synonyms: p8MTCP1; P13MTCP1; TCL1C
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001018025 edited; GGAACCCAAAGCCCAGAATGGCAGGAGAGGATGTGGGGGCTCCACCCGATCACCTCTGGG; TTCACCAAGAGGGTATCTACCGCGACGAATACCAGCGCACGTGGGTGGCCGTCGTGGAAG; AGGAGACGAGTTTCCTAAGGGCACGAGTCCAGCAAATTCAGGTTCCCTTAGGTGACGCAG; CTAGGCCAAGTCACCTTCTTACCTCCCAGCTACCTCTCATGTGGCAACTCTACCCGGAGG; AGCGCTACATGGATAACAACTCTCGCTTGTGGCAGATACAGCATCATTTAATGGTCAGGG; GAGTACAGGAGCTGTTGCTTAAGCTTTTGCCTGATGACTAA;
• Restriction Sites: Please inquire
• ACCN: NM_001018025
• Insert Size: 350 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001018025.2, NP_001018025.1
• RefSeq Size: 1943 bp
• RefSeq ORF: 324 bp
• Locus ID: 4515
• UniProt ID: P56278
• Cytogenetics: Xq28
• Summary: This gene was identified by involvement in some t(X;14) translocations associated with mature T-cell proliferations. This region has a complex gene structure, with a common promoter and 5' exon spliced to two different sets of 3' exons that encode two different proteins. This gene represents the upstream 13 kDa protein that is a member of the TCL1 family. This protein may be involved in leukemogenesis. [provided by RefSeq, Mar 2009]