OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SPOP (NM_001007229) Human Untagged Clone

Be the first to review this product
SKU
SC301171
SPOP (untagged)-Human speckle-type POZ protein (SPOP), transcript variant 6
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342120 Rabbit Polyclonal Anti-SPOP Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SPOP or NM_001007229"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPOP
Synonyms BTBD32; NEDMACE; NEDMIDF; NSDVS1; NSDVS2; TEF2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301171 representing NM_001007229.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAAGGGTTCCAAGTCCTCCACCTCCGGCAGAAATGTCGAGTGGCCCCGTAGCTGAGAGTTGGTGC
TACACACAGATCAAGGTAGTGAAATTCTCCTACATGTGGACCATCAATAACTTTAGCTTTTGCCGGGAG
GAAATGGGTGAAGTCATTAAAAGTTCTACATTTTCATCAGGAGCAAATGATAAACTGAAATGGTGTTTG
CGAGTAAACCCCAAAGGGTTAGATGAAGAAAGCAAAGATTACCTGTCACTTTACCTGTTACTGGTCAGC
TGTCCAAAGAGTGAAGTTCGGGCAAAATTCAAATTCTCCATCCTGAATGCCAAGGGAGAAGAAACCAAA
GCTATGGAGAGTCAACGGGCATATAGGTTTGTGCAAGGCAAAGACTGGGGATTCAAGAAATTCATCCGT
AGAGATTTTCTTTTGGATGAGGCCAACGGGCTTCTCCCTGATGACAAGCTTACCCTCTTCTGCGAGGTG
AGTGTTGTGCAAGATTCTGTCAACATTTCTGGCCAGAATACCATGAACATGGTAAAGGTTCCTGAGTGC
CGGCTGGCAGATGAGTTAGGAGGACTGTGGGAGAATTCCCGGTTCACAGACTGCTGCTTGTGTGTTGCC
GGCCAGGAATTCCAGGCTCACAAGGCTATCTTAGCAGCTCGTTCTCCGGTTTTTAGTGCCATGTTTGAA
CATGAAATGGAGGAGAGCAAAAAGAATCGAGTTGAAATCAATGATGTGGAGCCTGAAGTTTTTAAGGAA
ATGATGTGCTTCATTTACACGGGGAAGGCTCCAAACCTCGACAAAATGGCTGATGATTTGCTGGCAGCT
GCTGACAAGTATGCCCTGGAGCGCTTAAAGGTCATGTGTGAGGATGCCCTCTGCAGTAACCTGTCCGTG
GAGAACGCTGCAGAAATTCTCATCCTGGCCGACCTCCACAGTGCAGATCAGTTGAAAACTCAGGCAGTG
GATTTCATCAACTATCATGCTTCGGATGTCTTGGAGACCTCTGGGTGGAAGTCAATGGTGGTGTCACAT
CCCCACTTGGTGGCTGAGGCATACCGCTCTCTGGCTTCAGCACAGTGCCCTTTTCTGGGACCCCCACGC
AAACGCCTGAAGCAATCCTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001007229
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007229.1
RefSeq Size 2982 bp
RefSeq ORF 1125 bp
Locus ID 8405
UniProt ID O43791
Cytogenetics 17q21.33
MW 42.1 kDa
Summary This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. provided by RefSeq, Jul 2008
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Transcript variants 1-6 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001007229" in other vectors (6)
SKU Description Size Price
RC201551 SPOP (Myc-DDK-tagged)-Human speckle-type POZ protein (SPOP), transcript variant 6 10 ug
$457.00
RC201551L1 Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC201551L2 Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, mGFP tagged 10 ug
$757.00
RC201551L3 Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC201551L4 Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, mGFP tagged 10 ug
$757.00
RG201551 SPOP (tGFP-tagged) - Human speckle-type POZ protein (SPOP), transcript variant 6 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products