OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SMARCD3 (NM_001003801) Human Untagged Clone

Be the first to review this product
SKU
SC300553
SMARCD3 (untagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3), transcript variant 3
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811107 SMARCD3 mouse monoclonal antibody,clone OTI4G3 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SMARCD3 or NM_001003801"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SMARCD3
Synonyms BAF60C; CRACD3; Rsc6p
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001003801 edited
AGAGAGAGAGTGAGAGGAGCCGCTGAGCCCACCCCGATGGCCGCGGACGAAGTTGCCGGA
GGGGCGCGCAAAGCCACGAAAAGCAAACTTTTTGAGTTTCTGGTCCATGGGGTGCGCCCC
GGGATGCCGTCTGGAGCCCGGATGCCCCACCAGGGGGCGCCCATGGGCCCCCCGGGCTCC
CCGTACATGGGCAGCCCCGCCGTGCGACCCGGCCTGGCCCCCGCGGGCATGGAGCCCGCC
CGCAAGCGAGCAGCGCCCCCGCCCGGGCAGAGCCAGGCACAGAGCCAGGGCCAGCCGGTG
CCCACCGCCCCCGCGCGGAGCCGCAGTGCCAAGAGGAGGAAGATGGCTGACAAAATCCTC
CCTCAAAGGATTCGGGAGCTGGTCCCCGAGTCCCAGGCTTACATGGACCTCTTGGCATTT
GAGAGGAAACTGGATCAAACCATCATGCGGAAGCGGGTGGACATCCAGGAGGCTCTGAAG
AGGCCCATGAAGCAAAAGCGGAAGCTGCGACTCTATATCTCCAACACTTTTAACCCTGCG
AAGCCTGATGCTGAGGATTCCGACGGCAGCATTGCCTCCTGGGAGCTACGGGTGGAGGGG
AAGCTCCTGGATGATCCCAGCAAACAGAAGCGGAAGTTCTCTTCTTTCTTCAAGAGTTTG
GTCATCGAGCTGGACAAAGATCTTTATGGCCCTGACAACCACCTCGTTGAGTGGCATCGG
ACACCCACGACCCAGGAGACGGACGGCTTCCAGGTGAAACGGCCTGGGGACCTGAGTGTG
CGCTGCACGCTGCTCCTCATGCTGGACTACCAGCCTCCCCAGTTCAAACTGGATCCCCGC
CTAGCCCGGCTGCTGGGGCTGCACACACAGAGCCGCTCAGCCATTGTCCAGGCCCTGTGG
CAGTATGTGAAGACCAACAGGCTGCAGGACTCCCATGACAAGGAATACATCAATGGGGAC
AAGTATTTCCAGCAGATTTTTGATTGTCCCCGGCTGAAGTTTTCTGAGATTCCCCAGCGC
CTCACAGCCCTGCTATTGCCCCCTGACCCAATTGTCATCAACCATGTCATCAGCGTGGAC
CCTTCAGACCAGAAGAAGACGGCGTGCTATGACATTGACGTGGAGGTGGAGGAGCCATTA
AAGGGGCAGATGAGCAGCTTCCTCCTATCCACGGCCAACCAGCAGGAGATCAGTGCTCTG
GACAGTAAGATCCATGAGACGATTGAGTCCATAAACCAGCTCAAGATCCAGAGGGACTTC
ATGCTAAGCTTCTCCAGAGACCCCAAAGGCTATGTCCAAGACCTGCTCCGCTCCCAGAGC
CGGGACCTCAAGGTGATGACAGATGTAGCCGGCAACCCTGAAGAGGAGCGCCGGGCTGAG
TTCTACCACCAGCCCTGGTCCCAGGAGGCCGTCAGTCGCTACTTCTACTGCAAGATCCAG
CAGCGCAGGCAGGAGCTGGAGCAGTCGCTGGTTGTGCGCAACACCTAGGAGCCCAAAAAT
AAGCAGCACGACGGAACTTTCAGCCGTGTCCCGGGCCCCAGCATTTTGCCCCGGGCTCCA
GCATCACTCCTCTGCCACCTTGGGGTGTGGGGCTGGATTAAAAGTCATTCATCTGAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_001003801
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001003801.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001003801.1, NP_001003801.1
RefSeq Size 1700 bp
RefSeq ORF 1452 bp
Locus ID 6604
UniProt ID Q6STE5
Cytogenetics 7q36.1
Protein Families Druggable Genome, Transcription Factors
Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3), also known as hBAF60c2, has an alternate 5' sequence, as compared to variant 1. The encoded isoform 2 has a longer and distinct N-terminus, as compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001003801" in other vectors (4)
SKU Description Size Price
RC222004 SMARCD3 (Myc-DDK-tagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3), transcript variant 3 10 ug
$457.00
RC222004L3 Lenti-ORF clone of SMARCD3 (Myc-DDK-tagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3), transcript variant 3 10 ug
$757.00
RC222004L4 Lenti-ORF clone of SMARCD3 (mGFP-tagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3), transcript variant 3 10 ug
$757.00
RG222004 SMARCD3 (tGFP-tagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 (SMARCD3), transcript variant 3 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products