OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GPM6B (NM_001001994) Human Untagged Clone

Be the first to review this product
SKU
SC300380
GPM6B (untagged)-Human glycoprotein M6B (GPM6B), transcript variant 4
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA361526 GPM6B Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GPM6B or NM_001001994"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPM6B
Synonyms M6B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300380 representing NM_001001994.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCTGCTTTGAATGCTGCATCAAGTGTCTGGGAGGAGTCCCCTACGCCTCCCTGGTGGCCACCATC
CTCTGCTTCTCCGGGGTGGCCTTATTCTGCGGCTGTGGGCATGTGGCTCTCGCAGGCACCGTGGCGATT
CTTGAGCAACACTTCTCCACCAACGCCAGTGACCATGCCTTGCTGAGCGAGGTGATACAACTGATGCAG
TATGTCATCTATGGAATTGCGTCCTTTTTCTTCTTGTATGGGATCATTCTGTTGGCAGAAGGCTTTTAC
ACCACAAGTGCAGTGAAAGAACTGCACGGTGAGTTTAAAACAACCGCTTGTGGCCGATGCATCAGTGGA
ATGTTCGTTTTCCTCACCTATGTGCTTGGAGTGGCCTGGCTGGGTGTGTTTGGTTTCTCAGCGGTGCCC
GTGTTTATGTTCTACAACATATGGTCAACTTGTGAAGTCATCAAGTCACCGCAGACCAACGGGACCACG
GGTGTGGAGCAGATCTGTGTGGATATCCGACAATACGGTATCATTCCTTGGAATGCTTTCCCCGGAAAA
ATATGTGGCTCTGCCCTGGAGAACATCTGCAACACAAACGAGTTCTACATGTCCTATCACCTGTTCATT
GTGGCCTGTGCAGGAGCTGGTGCCACCGTCATTGCCCTGCTGATCTACATGATGGCTACTACATATAAC
TATGCGGTTTTGAAGTTTAAGAGTCGGGAAGATTGCTGCACTAAATTCTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001001994
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001001994.2
RefSeq Size 4699 bp
RefSeq ORF 741 bp
Locus ID 2824
UniProt ID Q13491
Cytogenetics Xp22.2
Protein Families Transmembrane
MW 26.8 kDa
Summary This gene encodes a membrane glycoprotein that belongs to the proteolipid protein family. Proteolipid protein family members are expressed in most brain regions and are thought to be involved in cellular housekeeping functions such as membrane trafficking and cell-to-cell communication. This protein may also be involved in osteoblast differentiation. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes Y and 22. provided by RefSeq, Jan 2016
Transcript Variant: This variant (4) uses an alternate exon structure in the 5' UTR and 5' coding region and uses an alternate splice site in the 3' terminal exon compared to variant 1. The encoded protein (isoform 4) is shorter and has distinct N- and C-termini, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001001994" in other vectors (4)
SKU Description Size Price
RC222760 GPM6B (Myc-DDK-tagged)-Human glycoprotein M6B (GPM6B), transcript variant 4 10 ug
$300.00
RC222760L3 Lenti ORF clone of Human glycoprotein M6B (GPM6B), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC222760L4 Lenti ORF clone of Human glycoprotein M6B (GPM6B), transcript variant 4, mGFP tagged 10 ug
$600.00
RG222760 GPM6B (tGFP-tagged) - Human glycoprotein M6B (GPM6B), transcript variant 4 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products