OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DUSP19 (NM_080876) Human Untagged Clone

Be the first to review this product
SKU
SC128060
DUSP19 (untagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 1
  $300.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DUSP19 or NM_080876"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DUSP19
Synonyms DUSP17; LMWDSP3; SKRP1; TS-DSP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_080876, the custom clone sequence may differ by one or more nucleotides


ATGTACTCCCTTAACCAGGAAATTAAAGCATTCTCCCGGAATAATCTCAGGAAGCAATGCACCAGGGTGA
CAACGCTAACTGGAAAGAAAATTATAGAAACATGGAAAGATGCCAGAATTCATGTTGTGGAAGAAGTAGA
GCCGAGCAGTGGGGGTGGTTGTGGTTATGTGCAGGACCTTAGCTCGGACCTGCAAGTTGGCGTTATTAAG
CCATGGTTGCTCCTAGGGTCACAAGATGCTGCTCATGATTTGGATACACTGAAAAAGAATAAGGTGACTC
ATATTCTTAATGTTGCATATGGAGTTGAAAATGCTTTCCTCAGTGACTTTACATATAAGAGCATTTCTAT
ATTGGATCTGCCTGAAACCAACATCCTGTCTTATTTTCCAGAATGTTTTGAATTTATTGAAGAAGCAAAA
AGAAAAGATGGAGTGGTTCTTGTTCATTGTAATGCAGGCGTTTCCAGGGCTGCTGCAATTGTAATAGGTT
TCCTGATGAATTCTGAACAAACCTCATTTACCAGTGCTTTTTCTTTGGTGAAAAATGCAAGACCTTCCAT
ATGTCCAAATTCTGGCTTCATGGAGCAGCTTCGTACATATCAAGAGGGCAAAGAAAGCAATAAGTGTGAC
AGAATACAGGAGAACAGTTCATGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_080876 unedited
NNNTTTATTGGNACTCCCCGCGGTGGCGGCCGCATAACTTCGTATAGCATACATTATACG
AAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGGGGTGGGATAAA
CGGAGCTGGACGACTCAGTCTCTTGGTCTGTGGCTGCTGCGGTTACCTGGATGGGCGAGC
ACCTCTGAGGCTGGCTTTGTTACCTGGGCAATAAGGGACTAGCAGTTCAGCCGTTTTCTA
TGCCTGCTGGATTTGTTTGTATTTGTTCCCAGCCACTGCTCATGTAATGTACTCCCTTAA
CCAGGAAATTAAAGCATTCTCCCGGAATAATCTCAGGAAGCAATGCACCAGGGTGACAAC
GCTAACTGGAAAGAAAATTATAGAAACATGGAAAGATGCCAGAATTCATGTTGTGGAAGA
AGTAGAGCCGAGCATGGGGTGGTGTGTGGTTTTATTGTGCANGGACCTTTANCTCGGACC
TGCAAGTTGGCGTTATTAAGCCATGGTTGCTCCTAGGGTCACAAGATGCTGCTCATGATT
TGGATACACTGAANAAGAATAAGGTGACTCATATTCTTAATGTTGCATATGGAGTTGAAA
ATGCTTTCCTCAGTGACTTTACATATAAGAGCATTTCTATATTGGATCTGCCTGAGACCA
ACATCCTGTCTTATTTTCCAGAATGTTTTTGAATTTATTGAAGAAGCAAAAAGAAAAGAT
GGAGTGGGTTCTTGTTCATTGTAATGCAGGCCGTTTCCAGGGCTGCTGCAATTGTAATAG
GTTTTCCTGATGAATTTCTGACAAACCTCATTTTACCATGCTTTTTCTTTTGTGAAAAAT
GCCAGAACTTCCCTATGTCCCAATTCTTGGCTTCATGGAGCACCTTCCTACATTTCAAGA
T
Restriction Sites Please inquire |
ACCN NM_080876
Insert Size 5200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080876.2, NP_543152.1
RefSeq Size 5183 bp
RefSeq ORF 654 bp
Locus ID 142679
UniProt ID Q8WTR2
Cytogenetics 2q32.1
Protein Families Druggable Genome, Phosphatase
Summary Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 PubMed 19228121).supplied by OMIM, Dec 2009
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_080876" in other vectors (6)
SKU Description Size Price
RC206095 DUSP19 (Myc-DDK-tagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 1 10 ug
$300.00
RC206095L1 Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC206095L2 Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 1, mGFP tagged 10 ug
$600.00
RC206095L3 Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC206095L4 Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 1, mGFP tagged 10 ug
$600.00
RG206095 DUSP19 (tGFP-tagged) - Human dual specificity phosphatase 19 (DUSP19), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products