OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DUSP21 (NM_022076) Human Untagged Clone

Be the first to review this product
SKU
SC127867
DUSP21 (untagged)-Human dual specificity phosphatase 21 (DUSP21)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DUSP21 or NM_022076"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DUSP21
Synonyms LMWDSP21
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127867 sequence for NM_022076 edited (data generated by NextGen Sequencing)
ATGACAGCATCCGCGTCCTCCTTTTCATCATCTCAGGGTGTCCAGCAGCCCTCCATCTAC
AGCTTCTCCCAAATAACCAGAAGCTTGTTTCTCAGCAATGGTGTGGCCGCCAACGACAAA
CTCCTTCTGTCCAGCAATCGCATCACCGCCATTGTCAATGCCTCGGTGGAAGTGGTCAAC
GTATTCTTCGAGGGCATTCAGTACATAAAGGTGCCTGTTACCGATGCTCGTGACTCGCGT
CTCTACGACTTTTTTGACCCCATTGCTGATCTTATCCACACCATCGATATGAGGCAGGGC
CGTACGCTGCTGCACTGCATGGCTGGAGTGAGCCGTTCCGCCTCACTGTGCCTTGCGTAC
CTCATGAAATACCACTCCATGTCGCTGCTGGACGCCCATACATGGACCAAGTCGCGCCGC
CCCATCATCCGGCCCAACAACGGCTTTTGGGAACAGCTCATCAATTACGAATTCAAGCTG
TTTAATAACAACACCGTGCGCATGATCAACTCGCCGGTAGGTAACATCCCTGACATCTAT
GAGAAGGACCTACGTATGATGATATCAATGTAA

Clone variation with respect to NM_022076.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_022076 unedited
GCGGCCGCGAATTCAGATCTGGTACCGCCTTGATGACAGCATCCGCGTCCTCCTTTTCAT
CATCTCAGGGTGTCCAGCAGCCCTCCATCTACAGCTTCTCCCAAATAACCAGAAGCTTGT
TTCTCAGCAATGGTGTGGCCGCCAACGACAAACTCCTTCTGTCCAGCAATCGCATCACCG
CCATTGTCAATGCCTCGGTGGAAGTGGTCAACGTATTCTTCGAGGGCATTCAGTACATAA
AGGTGCCTGTTACCGATGCTCGTGACTCGCGTCTCTACGACTTTTTTGACCCCATTGCTG
ATCTTATCCACACCATCGATATGAGGCAGGGCCGTACGCTGCTGCACTGCATGGCTGGAG
TGAGCCGTTCCGCCTCACTGTGCCTTGCGTACCTCATGAAATACCACTCCATGTCGCTGC
TGGACGCCCATACATGGACCAAGTCGCGCCGCCCCATCATCCGGCCCAACAACGGCTTTT
GGGAACAGCTCATCAATTACGAATTCAAGCTGTTTAATAACAACACCGTGCGCATGATCA
ACTCGCCGGTAGGTAACATCCCTGACATCTATGAGAAGGACCTACGTATGATGATATCAA
TGTAAGCCATCCCGGCCAGCCCCTGACATCTGCCATCGATCTTGCTCGACTCTAGATTGC
GGCCGCGGTCATAGCT
Restriction Sites Please inquire |
ACCN NM_022076
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022076.2, NP_071359.2
RefSeq Size 889 bp
RefSeq ORF 573 bp
Locus ID 63904
UniProt ID Q9H596
Cytogenetics Xp11.3
Protein Families Druggable Genome, Phosphatase
Summary This gene encodes a member of the dual specificity phosphatase family, specifically the low molecular weight dual specificity phosphatase family. The encoded protein localizes to both the cytoplasm and the nucleus and functions to remove phosphate groups from phosphotyrosine and phosphothreonine residues.provided by RefSeq, Mar 2009
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_022076" in other vectors (6)
SKU Description Size Price
RC218231 DUSP21 (Myc-DDK-tagged)-Human dual specificity phosphatase 21 (DUSP21) 10 ug
$300.00
RC218231L1 Lenti ORF clone of Human dual specificity phosphatase 21 (DUSP21), Myc-DDK-tagged 10 ug
$600.00
RC218231L2 Lenti ORF clone of Human dual specificity phosphatase 21 (DUSP21), mGFP tagged 10 ug
$600.00
RC218231L3 Lenti ORF clone of Human dual specificity phosphatase 21 (DUSP21), Myc-DDK-tagged 10 ug
$600.00
RC218231L4 Lenti ORF clone of Human dual specificity phosphatase 21 (DUSP21), mGFP tagged 10 ug
$600.00
RG218231 DUSP21 (tGFP-tagged) - Human dual specificity phosphatase 21 (DUSP21) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products