OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

IMP4 (NM_033416) Human Untagged Clone

Be the first to review this product
SKU
SC127736
IMP4 (untagged)-Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4)
  $300.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA358869 IMP4 Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "IMP4 or NM_033416"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IMP4
Synonyms BXDC4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033416, the custom clone sequence may differ by one or more nucleotides


ATGCTGCGCCGCGAGGCCCGCCTGCGCCGCGAGTACCTGTACCGCAAGGCCCGGGAGGAGGCGCAGCGCT
CAGCCCAGGAGAGGAAGGAGCGGCTGCGGCGCGCGCTGGAAGAAAACCGCCTGATTCCCACTGAGTTACG
CCGAGAGGCTCTGGCCTTACAGGGGTCCCTGGAGTTTGATGATGCTGGAGGTGAAGGTGTGACCAGCCAC
GTGGATGATGAATACCGATGGGCAGGAGTCGAGGATCCCAAGGTTATGATCACTACCTCCCGAGACCCCA
GTTCCCGCCTCAAGATGTTTGCAAAGGAGCTGAAGCTGGTGTTCCCGGGCGCCCAGCGAATGAACCGAGG
TCGACATGAAGTGGGGGCACTGGTGCGAGCCTGCAAAGCCAACGGCGTCACCGATCTGCTGGTCGTTCAC
GAGCATCGGGGCACACCTGTGGGGCTCATCGTCAGCCACCTGCCCTTTGGTCCTACTGCCTACTTCACGC
TGTGCAATGTGGTCATGCGGCATGACATCCCAGACCTGGGCACCATGTCGGAGGCCAAGCCCCACCTCAT
CACACACGGCTTCTCCTCCCGCCTGGGCAAGCGGGTCTCTGACATCCTCCGATACCTATTTCCCGTGCCC
AAAGATGACAGCCACCGGGTCATCACCTTCGCAAACCAGGACGACTACATATCATTCCGGCACCATGTGT
ATAAGAAGACAGACCACCGCAACGTGGAGCTCACTGAGGTCGGGCCCCGCTTTGAGCTGAAGCTGTACAT
GATCCGTCTGGGCACGCTGGAGCAGGAGGCCACAGCAGACGTGGAGTGGCGCTGGCACCCTTACACCAAT
ACCGCACGCAAGAGAGTCTTCCTGAGCACCGAGTGA
Restriction Sites Please inquire |
ACCN NM_033416
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033416.1, NP_219484.1
RefSeq Size 1074 bp
RefSeq ORF 876 bp
Locus ID 92856
UniProt ID Q96G21
Cytogenetics 2q21.1
Domains Brix
Summary The protein encoded by this gene, along with IMP3 and MPP10, is part of the 60-80S U3 small nucleolar ribonucleoprotein (U3 snoRNP) complex. This complex is necessary for the early cleavage steps of pre-18S ribosomal RNA processing. Several transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Feb 2016
Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_033416" in other vectors (4)
SKU Description Size Price
RC204015 IMP4 (Myc-DDK-tagged)-Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4) 10 ug
$300.00
RC204015L3 Lenti ORF clone of Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4), Myc-DDK-tagged 10 ug
$600.00
RC204015L4 Lenti ORF clone of Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4), mGFP tagged 10 ug
$600.00
RG204015 IMP4 (tGFP-tagged) - Human IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP4) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products