OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LAMTOR1 (NM_017907) Human Untagged Clone

Be the first to review this product
SKU
SC126849
LAMTOR1 (untagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1)
  $150.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LAMTOR1 or NM_017907"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LAMTOR1
Synonyms C11orf59; p18; p27RF-Rho; PDRO; Ragulator1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_017907, the custom clone sequence may differ by one or more nucleotides


ATGGGGTGCTGCTACAGCAGCGAGAACGAGGACTCGGACCAGGACCGAGAGGAGCGGAAGCTGCTGCTGG
ACCCTAGCAGCCCCCCTACCAAAGCTCTCAATGGAGCCGAGCCCAACTACCACAGCCTGCCTTCCGCTCG
CACTGATGAGCAGGCCCTGCTCTCTTCCATCCTTGCCAAGACAGCCAGCAACATCATTGATGTGTCTGCT
GCAGACTCACAGGGCATGGAGCAGCATGAGTACATGGACCGTGCCAGGCAGTACAGCACCCGCTTGGCTG
TGCTGAGCAGCAGCCTGACCCATTGGAAGAAGCTGCCACCGCTGCCGTCTCTTACCAGCCAGCCCCACCA
AGTGCTGGCCAGTGAGCCCATCCCGTTCTCTGATTTGCAGCAGGTCTCCAGGATAGCTGCTTATGCCTAC
AGTGCACTTTCTCAGATCCGTGTGGACGCAAAAGAGGAGCTGGTTGTACAGTTTGGGATCCCATGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_017907 unedited
GAATTTGTAATACGACTTACTATAGGGCGGCCGCGAATTCGGCACGAGGCCTCCTCGGCG
CGGCCTGAGCGCCCGGCCCGACCCCGGCCATGGGGTGCTGCTACAGCAGCGAGAACGAGG
ACTCGGACCAGGACCGAGAGGAGCGGAAGCTGCTGCTGGACCCTAGCAGCCCCCCTACCA
AAGCTCTCAATGGAGCCGAGTCCAACTACCACAGCCTGCCTTCCGCTCGCACTGATGAGC
AGGCCCTGCTCTCTTCCATCCTTGCCAAGACAGCCAGCAACATCATTGATGTGTCTGCTG
CAGACTCACAGGGCATGGAGCAGCATGAGTACATGGACCGTGCCAGGCAGTACAGCACCC
GCTTGGCTGTGCTGAGCAGCAGCCTGACCCATTGGAAGAAGCTGCCACCGCTGCCGTCTC
TTACCAGCCAGCCCCACCAAGTGCTGGCCAGTGAGCCCATCCCGTTCTCTGATTTGCAGC
AGGTCTCCAGGATAGCTGCTTATGCCTACAGTGCACTTTCTCAGATCCGTGTGGACGCAA
AAGAGGAGCTGGTTGTACAGTTTGGGATCCCATGAAGAGAGGGGTCCTTGGACAGCTCTT
CTCCTCTCTTCATCCCATCTCTACCCCACCCCCTTGGCCCCCAGCCTCACTGCGGCTTAT
ACAGTACCCTAACCTGCTACTAATCACAGAGAAAAATGTGAAGAAGGAGGAGAAGAGGAA
GGCTANAAGCCTGAGCAGTGAGGGTAGAACCTTTTGGGACTGGCCTTTNGAGCTCTGGCC
AGGGATGGGNGTGGGGGCCAAAAGGACAGAGCCTGGTATGTCTTCATAGTCATTGAGAAT
GTGGGAGAACCAGTTTGGGTGGGNGGGGTGATCACCANGGGACCCTAGGAGATCCCNTTN
CCACCNTCTCTGNTGA
Restriction Sites NotI-NotI |
ACCN NM_017907
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017907.1, NP_060377.1
RefSeq Size 1112 bp
RefSeq ORF 486 bp
Locus ID 55004
UniProt ID Q6IAA8
Cytogenetics 11q13.4
Summary As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. LAMTOR1 is directly responsible for anchoring the Ragulator complex to membranes. Also required for late endosomes/lysosomes biogenesis it may regulate both the recycling of receptors through endosomes and the MAPK signaling pathway through recruitment of some of its components to late endosomes. May be involved in cholesterol homeostasis regulating LDL uptake and cholesterol release from late endosomes/lysosomes. May also play a role in RHOA activation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_017907" in other vectors (6)
SKU Description Size Price
RC200159 LAMTOR1 (Myc-DDK-tagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1) 10 ug
$150.00
RC200159L1 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1), Myc-DDK-tagged 10 ug
$450.00
RC200159L2 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1), mGFP tagged 10 ug
$450.00
RC200159L3 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1), Myc-DDK-tagged 10 ug
$450.00
RC200159L4 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1), mGFP tagged 10 ug
$450.00
RG200159 LAMTOR1 (tGFP-tagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 (LAMTOR1) 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products