OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

robld3 (LAMTOR2) (NM_014017) Human Untagged Clone

Be the first to review this product
SKU
SC125660
LAMTOR2 (untagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA349022 Rabbit Polyclonal Anti-LAMTOR2 Antibody
100 ug
$640.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "robld3 or NM_014017"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol robld3
Synonyms ENDAP; HSPC003; MAPBPIP; MAPKSP1AP; p14; Ragulator2; ROBLD3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014017 edited
GAGATCTGGGTGCAAAAGCCCAGGGTTAGGAACCGTAGGCATGCTGCGCCCCAAGGCTTT
GACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAGAGCACCCTGCTGCTGAATAA
CGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACTGACGCCCGGGTCACCGCTGC
CATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGGAACCAAGCGTTTAATGAAGA
CAATCTCAAATTCATCCTCATGGACTGCATGGAGGGCCGTGTAGCCATCACCCGAGTGGC
CAACCTTCTGCTGTGTATGTATGCCAAGGAGACCGTGGGCTTTGGAATGCTCAAGGCCAA
GGCCCAGGCTTTGGTGCAGTACCTGGAGGAGCCCCTCACCCAAGTGGCGGCATCTTAACG
GCATTGGTGGAAGCTGGGGTCAGAAAAGAGAAATGACCATTTGGAGGGGCGGGGCCTCCT
AGAAGAACCTTCTTAGACAATGGGGGGAGGATGGGACTTTGTTTTTTCCAAGAATAAACT
TCAACTCCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_014017 unedited
CACGAGGGAGATCTGGGTGCAAAAGCCCAGGGTTAGGAACCGTAGGCATGCTGCGCCCCA
AGGCTTTGACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAGAGCACCCTGCTGC
TGAATAACGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACTGACGCCCGGGTCA
CCGCTGCCATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGGAACCAAGCGTTTA
ATGAAGACAATCTCAAATTCATCCTCATGGACTGCATGGAGGGCCGTGTAGCCATCACCC
GAGTGGCCAACCTTCTGCTGTGTATGTATGCCAAGGAGACCGTGGGCTTTGGAATGCTCA
AGGCCAAGGCCCAGGCTTTGGTGCAGTACCTGGAGGAGCCCCTCACCCAAGTGGCGGCAT
CTTAACGGCATTGGTGGAAGCTGGGGTCAGAAAAGAGAAATGACCATTTGGAGGGGCGGG
GCCTCCTAGAAGAACCTTCTTAGACAATGGGGGGAGGATGGGACTTTGTTTTTTCCAAGA
ATAAACTTCAACTCCTGT
Restriction Sites NotI-NotI |
ACCN NM_014017
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014017.1, NP_054736.1
RefSeq Size 602 bp
RefSeq ORF 378 bp
Locus ID 28956
UniProt ID Q9Y2Q5
Cytogenetics 1q22
Summary The product of this gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Feb 2009
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014017" in other vectors (6)
SKU Description Size Price
RC200862 LAMTOR2 (Myc-DDK-tagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1 10 ug
$150.00
RC200862L1 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200862L2 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1, mGFP tagged 10 ug
$450.00
RC200862L3 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200862L4 Lenti ORF clone of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG200862 LAMTOR2 (tGFP-tagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products