OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

beta 2 Microglobulin (B2M) (NM_004048) Human Untagged Clone

Be the first to review this product
SKU
SC117632
B2M (untagged)-Human beta-2-microglobulin (B2M)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA802776JM B2M mouse monoclonal antibody,clone 1A9, Magnetic Beads 1 ml
$798.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "beta 2 Microglobulin or NM_004048"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol beta 2 Microglobulin
Synonyms IMD43
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117632 sequence for NM_004048 edited (data generated by NextGen Sequencing)
ATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCT
ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCA
AATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTG
AAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGG
TCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGC
CGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAA

Clone variation with respect to NM_004048.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004048 unedited
AGATTTCGGATTTTGTAAATCCGNACTTCACTATAGGGCGGCACGCCAATTCGGCACGAG
GCAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTC
TTTCTGGCCTGGAGGCTATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAG
CAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGTGTTTCATCCATCCGACA
TTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGT
CTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAA
AAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGT
GGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATG
AATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTAT
GCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACT
TTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGA
GGGCTGGCAACTTAGAGGTGGGGAGCAGAGAATTCTCTTATCCAACATCAACATCTTGGT
CAGATTTGAACTCTTCAATCTCTTGCACTCAAAGCTTGTTAAGATAGTTAAGCGTGCATA
AGTTAACTTCCAATTTACATACTCTGCTTAGAATTTGGGGAAAATTTTAGAAATATATTG
ACAGGATTATTGGAAATTTGTTATAATGAATGAAACATTTTGTCATATNAGATTCATATT
TACTTTCTAN
Restriction Sites NotI-NotI |
ACCN NM_004048
Insert Size 360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004048.2, NP_004039.1
RefSeq Size 987 bp
RefSeq ORF 360 bp
Locus ID 567
UniProt ID P61769
Cytogenetics 15q21.1
Domains ig, IGc1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Antigen processing and presentation
Summary This gene encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells. The protein has a predominantly beta-pleated sheet structure that can form amyloid fibrils in some pathological conditions. The encoded antimicrobial protein displays antibacterial activity in amniotic fluid. A mutation in this gene has been shown to result in hypercatabolic hypoproteinemia.provided by RefSeq, Aug 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004048" in other vectors (6)
SKU Description Size Price
RC207587 B2M (Myc-DDK-tagged)-Human beta-2-microglobulin (B2M) 10 ug
$150.00
RC207587L1 Lenti ORF clone of Human beta-2-microglobulin (B2M), Myc-DDK-tagged 10 ug
$450.00
RC207587L2 Lenti ORF clone of Human beta-2-microglobulin (B2M), mGFP tagged 10 ug
$450.00
RC207587L3 Lenti ORF clone of Human beta-2-microglobulin (B2M), Myc-DDK-tagged 10 ug
$450.00
RC207587L4 Lenti ORF clone of Human beta-2-microglobulin (B2M), mGFP tagged 10 ug
$450.00
RG207587 B2M (tGFP-tagged) - Human beta-2-microglobulin (B2M) 10 ug
$489.00

file-alt Citations

Gemcitabine alters the proteasome composition and immunopeptidome of tumour cells
Gravett, Trautwein, Stevanović et al
OncoImmunology (2018)
AI Summary: OriGene's pCMV6-XL5 plasmid expressing human β2m (NM_004048) was used to transfect tumour cells, enabling the study of how gemcitabine affects proteasome composition and the immunopeptidome.
Snippet: Tumour cells were transfected with a human β2m (NM_004048) expressing, pCM V6 - XL5 plasmid (OriGene, Herford, Germany) using Lipofectamine LTX (HCT116 cells) or Lipofectamine 3000 (A549 and MCF - 7 cells) (Invitogen) and following manufacturer’s instructions
Characterization and cellular localization of human 5-lipoxygenase and its protein isoforms 5-LOΔ13, 5-LOΔ4 and 5-LOp12
Ball, Beilstein, Wittmann et al
Biochim. Biophys. Acta (2017) 1862 (5), 561-571 DOI: 10.1016/j.bbalip.2017.02.015
Snippet: For positive controls, PCR was carried out with pcDNA3.1-5LO, pcDNA3.1-5LOΔ4, pcDNA3.1-5LOΔ13 and pcDNA3.1-5LOp12. The positive control pCMV6-XL5-β2M plasmid was bought from OriGene (Rockville, MD, USA). ... All 2 versions Cite SaveSaving
Identification and Characterization of a New Protein Isoform of Human 5-Lipoxygenase
Häfner, Beilstein, Graab et al
PLoS ONE (2016) 11 (11), e0166591 DOI: 10.1371/journal.pone.0166591
AI Summary: OriGene contributed to this study by providing the pCMV6-XL5-B2M plasmid, which was used in the experiments described.
Snippet: Germany). The pCMV6-XL5 -B2M plasmid was bought from OriGene(Rockville, MD, USA), the plasmid pT3-5LO was a kind gift of Dr. Olof Rdmark (KarolinskaInstitutet, Stockholm, Sweden). Methods. Cell culture. Raji and ... Cite SaveSaving
Position 97 of HLA-B, a residue implicated in pathogenesis of ankylosing spondylitis, plays a key role in cell surface free heavy chain expression
Chen, Shi, Yuan et al
Ann. Rheum. Dis. (2016)
Cited by 19
AI Summary: OriGene’s β2m plasmid (SC117632) was used to study the role of β2-microglobulin in HLA-B*27 surface expression and its mutants in this research on ankylosing spondylitis.
Snippet: The β2m plasmid was purchased from Origene (SC117632);loss-of-function β2m-C25W plasmid was generated using the same kit described above (primer: CAAATTTCCTGAATTGGTATGTGTCTGGG). Generation of ERAP1 ... Cite SaveSaving
Cross-species analysis of Fc engineered anti-Lewis-Y human IgG1 variants in human neonatal receptor transgenic mice reveal importance of S254 and Y436 in binding human neonatal Fc receptor
Burvenich, Farrugia, Lee et al
MAbs (2016) 8 (4), 775-86 DOI: 10.1080/19420862.2016.1156285
AI Summary: OriGene products, specifically the human FcRn cDNA (SC117595) and β2m cDNA (SC117632) clones, were used to facilitate the study of Fc-engineered IgG1 variants' binding to human neonatal Fc receptor in this research.
Snippet: Human FcRn cDNA (SC117595) and β2m cDNA (SC117632) clones were obtained from OriGene Technologies
IgG1 Allotypes Influence the Pharmacokinetics of Therapeutic Monoclonal Antibodies through FcRn Binding
Ternant, Arnoult, Pugnière et al
J. Immunol. (2015)
Cited by 76
AI Summary: OriGene contributed the pCMV-SPORT6 plasmid encoding human β2-microglobulin (NM_004048.2), which was used in the study to investigate FcRn-mediated interactions affecting monoclonal antibody pharmacokinetics.
Snippet: obtain pCMV6hFcRn. A histidine tag was introduced into the plasmid, resulting in pCMV6hFcRn-His. The pCMV-SPORT6 plasmid encoding the human b2-microglobulin (NM_004048.2) was obtained from OriGene. The two ... Cite SaveSaving
Showing 1-6 of 7 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products