OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CEE (GET4) (NM_015949) Human Untagged Clone

Be the first to review this product
SKU
SC114540
GET4 (untagged)-Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA343126 Rabbit Polyclonal Anti-GET4 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CEE or NM_015949"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CEE
Synonyms C7orf20; CEE; CGI-20; TRC35
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_015949, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGCGGCGGCGATGGCCGAGCAGGAGAGCGCCCGGAACGGCGGCCGCAACCGCGGCGGCGTCC
AGCGTGTGGAGGGCAAGCTGCGCGCCAGCGTCGAGAAGGGCGACTACTACGAGGCGCACCAGATGTACCG
GACCCTGTTCTTCAGGTACATGTCCCAGAGCAAGCACACGGAGGCCCGGGAGCTCATGTACTCGGGAGCC
CTGCTCTTCTTCAGCCATGGCCAGCAAAACAGTGCAGCAGACTTGTCCATGCTGGTCCTGGAGTCCCTGG
AGAAGGCGGAAGTGGAGGTGGCTGACGAGCTGCTGGAAAATCTGGCTAAAGTGTTCAGCCTGATGGACCC
CAACTCTCCTGAGCGCGTGACCTTTGTGTCCAGAGCCCTGAAGTGGTCCAGTGGGGGCTCCGGGAAGCTG
GGCCACCCCCGGCTGCACCAGCTGCTGGCCCTCACCCTGTGGAAAGAACAAAACTATTGTGAGTCGAGGT
ATCATTTTCTGCACTCAGCGGACGGGGAGGGCTGTGCCAACATGCTGGTGGAGTATTCCACGTCCCGCGG
CTTCCGCAGCGAGGTGGACATGTTCGTGGCCCAGGCCGTGCTACAGTTTCTCTGTTTAAAAAACAAAAGT
AGCGCATCGGTGGTCTTCACGACGTACACCCAGAAGCACCCGTCCATCGAGGACGGGCCTCCGTTTGTGG
AGCCGCTGCTTAACTTCATCTGGTTCCTGCTGCTGGCTGTGGACGGTGGGAAGCTGACGGTGTTCACTGT
GCTGTGTGAGCAGTACCAGCCATCCCTCCGGCGGGACCCCATGTACAACGAGTACCTCGACCGCATAGGA
CAGCTGTTCTTCGGCGTCCCGCCCAAGCAGACGTCTTCCTACGGGGGCCTGCTCGGGAACCTTCTGACCA
GCCTCATGGGCTCCTCAGAGCAGGAGGATGGGGAGGAGAGCCCCAGCGACGGCAGCCCCATCGAGCTGGA
CTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_015949 unedited
ATAGGCGGCACGCGAATTCGCACGAGGGATAGCGCCCGGAACGGCGGCCGCAACCGCGGC
GGCGTCCAGCGTGTGGAGGGCAAGCTGCGCGCCAGCGTCGAGAAGGGCGACTACTACGAG
GCGCACCAGATGTACCGGACCCTGTTCTTCAGGTACATGTCCCAGAGCAAGCACACGGAG
GCCCGGGAGCTCATGTACTCGGGAGCCCTGCTCTTCTTCAGCCATGGCCAGCAAAACAGT
GCAGCAGACTTGTCCATGCTGGTCCTGGAGTCCCTGGAGAAGGCGGAAGTGGAGGTGGCT
GACGAGCTGCTGGAAAATCTGGCTAAAGTGTTCAGCCTGATGGACCCCAACTCTCCTGAG
CGCGTGACCTTTGTGTCCAGAGCCCTGAAGTGGTCCAGTGGGGGCTCCGGGAAGCTGGGC
CACCCCCGGCTGCACCAGCTGCTGGCCCTCACCCTGTGGAAAGAACAAAACTATTGTGAG
TCGAGGTATCATTTTCTGCACTCAGCGGACGGGGAGGGCTGTGCCAACATGCTGGTGGAG
TATTCCACGTCCCGCGGCTTCCGCAGCGAGGTGGACATGTTCGTGGCTCAAGCCGTGCTA
CAGTTTCTCTGTTTAAAAAACAAAAGTAGCGCATCGGGTGGTCTTCACGACGTACACCCA
GAAGCACCCGTCCATCGAGGACGGGCCTNCGTTTGTGGAGCCGCTGCTTAACTCATCTGG
TTCCTGCTGCTGGCTGNNGGACGGTGGGAGCTNNACGTGGTCACTTGGGCTGTGTGAACA
GTACCAGCATTCCTTNCGGGGGACCCATGTCCACGAGTACTCGACGCTAGGACAGCTGTT
TTTTGGGGGTCCGCAAACAACGCTCTTAAAGGGGGCCTGTTGGGACCTTTGACAGCTCTG
GCTCTCAAAGAGGAG
Restriction Sites NotI-NotI |
ACCN NM_015949
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015949.2, NP_057033.2
RefSeq Size 2106 bp
RefSeq ORF 984 bp
Locus ID 51608
UniProt ID Q7L5D6
Cytogenetics 7p22.3
Summary As part of a cytosolic protein quality control complex, the BAG6/BAT3 complex, maintains misfolded and hydrophobic patches-containing proteins in a soluble state and participates to their proper delivery to the endoplasmic reticulum or alternatively can promote their sorting to the proteasome where they undergo degradation (PubMed:20676083, PubMed:21636303, PubMed:21743475, PubMed:28104892). The BAG6/BAT3 complex is involved in the post-translational delivery of tail-anchored/type II transmembrane proteins to the endoplasmic reticulum membrane. Recruited to ribosomes, it interacts with the transmembrane region of newly synthesized tail-anchored proteins and together with SGTA and ASNA1 mediates their delivery to the endoplasmic reticulum (PubMed:20676083, PubMed:28104892, PubMed:25535373). Client proteins that cannot be properly delivered to the endoplasmic reticulum are ubiquitinated and sorted to the proteasome (PubMed:28104892). Similarly, the BAG6/BAT3 complex also functions as a sorting platform for proteins of the secretory pathway that are mislocalized to the cytosol either delivering them to the proteasome for degradation or to the endoplasmic reticulum (PubMed:21743475). The BAG6/BAT3 complex also plays a role in the endoplasmic reticulum-associated degradation (ERAD), a quality control mechanism that eliminates unwanted proteins of the endoplasmic reticulum through their retrotranslocation to the cytosol and their targeting to the proteasome. It maintains these retrotranslocated proteins in an unfolded yet soluble state condition in the cytosol to ensure their proper delivery to the proteasome (PubMed:21636303).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_015949" in other vectors (6)
SKU Description Size Price
RC200220 GET4 (Myc-DDK-tagged)-Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4) 10 ug
$300.00
RC200220L1 Lenti ORF clone of Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4), Myc-DDK-tagged 10 ug
$600.00
RC200220L2 Lenti ORF clone of Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4), mGFP tagged 10 ug
$600.00
RC200220L3 Lenti ORF clone of Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4), Myc-DDK-tagged 10 ug
$600.00
RC200220L4 Lenti ORF clone of Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4), mGFP tagged 10 ug
$600.00
RG200220 GET4 (tGFP-tagged) - Human golgi to ER traffic protein 4 homolog (S. cerevisiae) (GET4) 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products