OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LAPTM4B (NM_018407) Human Untagged Clone

Be the first to review this product
SKU
SC113496
LAPTM4B (untagged)-Human lysosomal protein transmembrane 4 beta (LAPTM4B)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342374 Rabbit Polyclonal Anti-LAPTM4B Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LAPTM4B or NM_018407"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LAPTM4B
Synonyms LAPTM4beta; LC27
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC113496 sequence for NM_018407 edited (data generated by NextGen Sequencing)
ATGACGTCACGGACTCGGGTCACATGGCCAAGTCCGCCCCGCCCCCTCCCCGTCCCCGCC
GCTGCAGCGGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTCTCGG
GGTATCGAGGAGGCAGGCCCGCGGGCGCACGGGCGAGCGGGCCGGGAGCCGGAGCGGCGG
AGGAGCCGGCAGCAGCGGCGCGGCGGGCTCCAGGCGAGGCGGTCGACGCTCCTGAAAACT
TGCGCGCGCGCTCGCGCCACTGCGCCCGGAGCGATGAAGATGGTCGCGCCCTGGACGCGG
TTCTACTCCAACAGCTGCTGCTTGTGCTGCCATGTCCGCACCGGCACCATCCTGCTCGGC
GTCTGGTATCTGATCATCAATGCTGTGGTACTGTTGATTTTATTGAGTGCCCTGGCTGAT
CCGGATCAGTATAACTTTTCAAGTTCTGAACTGGGAGGTGACTTTGAGTTCATGGATGAT
GCCAACATGTGCATTGCCATTGCGATTTCTCTTCTCATGATCCTGATATGTGCTATGGCT
ACTTACGGAGCGTACAAGCAACGCGCAGCCTGGATCATCCCATTCTTCTGTTACCAGATC
TTTGACTTTGCCCTGAACATGTTGGTTGCAATCACTGTGCTTATTTATCCAAACTCCATT
CAGGAATACATACGGCAACTGCCTCCTAATTTTCCCTACAGAGATGATGTCATGTCAGTG
AATCCTACCTGTTTGGTCCTTATTATTCTTCTGTTTATTAGCATTATCTTGACTTTTAAG
GGTTACTTGATTAGCTGTGTTTGGAACTGCTACCGATACATCAATGGTAGGAACTCCTCT
GATGTCCTGGTTTATGTTACCAGCAATGACACTACGGTGCTGCTACCCCCGTATGATGAT
GCCACTGTGAATGGTGCTGCCAAGGAGCCACCGCCACCTTACGTGTCTGCCTAA

Clone variation with respect to NM_018407.4
Restriction Sites NotI-NotI |
ACCN NM_018407
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018407.3, NP_060877.3
RefSeq Size 2245 bp
RefSeq ORF 954 bp
Locus ID 55353
UniProt ID Q86VI4
Cytogenetics 8q22.1
Domains Mtp
Protein Families Transmembrane
Protein Pathways Lysosome
Summary Required for optimal lysosomal function (PubMed:21224396). Blocks EGF-stimulated EGFR intraluminal sorting and degradation. Conversely by binding with the phosphatidylinositol 4,5-bisphosphate, regulates its PIP5K1C interaction, inhibits HGS ubiquitination and relieves LAPTM4B inhibition of EGFR degradation (PubMed:25588945). Recruits SLC3A2 and SLC7A5 (the Leu transporter) to the lysosome, promoting entry of leucine and other essential amino acid (EAA) into the lysosome, stimulating activation of proton-transporting vacuolar (V)-ATPase protein pump (V-ATPase) and hence mTORC1 activation (PubMed:25998567). Plays a role as negative regulator of TGFB1 production in regulatory T cells (PubMed:26126825). Binds ceramide and facilitates its exit from late endosome in order to control cell death pathways (PubMed:26280656).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018407" in other vectors (6)
SKU Description Size Price
RC207325 LAPTM4B (Myc-DDK-tagged)-Human lysosomal protein transmembrane 4 beta (LAPTM4B) 10 ug
$300.00
RC207325L1 Lenti ORF clone of Human lysosomal protein transmembrane 4 beta (LAPTM4B), Myc-DDK-tagged 10 ug
$600.00
RC207325L2 Lenti ORF clone of Human lysosomal protein transmembrane 4 beta (LAPTM4B), mGFP tagged 10 ug
$600.00
RC207325L3 Lenti ORF clone of Human lysosomal protein transmembrane 4 beta (LAPTM4B), Myc-DDK-tagged 10 ug
$600.00
RC207325L4 Lenti ORF clone of Human lysosomal protein transmembrane 4 beta (LAPTM4B), mGFP tagged 10 ug
$600.00
RG207325 LAPTM4B (tGFP-tagged) - Human lysosomal protein transmembrane 4 beta (LAPTM4B) 10 ug
$500.00

file-alt Citations

LAPTMs regulate lysosomal function and interact with mucolipin 1: new clues for understanding mucolipidosis type IV
Vergarajauregui, Martina, Puertollano
J. Cell. Sci. (2011) 124 (Pt 3), 459-68 DOI: 10.1242/jcs.076240
Cited by 68
AI Summary: In this study, OriGene products including human MCOLN1 cDNA (OriGene, SC322723), LAPTM4A cDNA (OriGene, SC119463), and LAPTM4B cDNA (OriGene, SC119464) were used for overexpression experiments to investigate the interactions and functional relationship between MCOLN1 and LAPTMs in lysosomal regulation.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products