OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TEAD4 (NM_003213) Human Untagged Clone

Be the first to review this product
SKU
SC111037
TEAD4 (untagged)-Human TEA domain family member 4 (TEAD4), transcript variant 1
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA343373 Rabbit Polyclonal Anti-TEAD4 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TEAD4 or NM_003213"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TEAD4
Synonyms EFTR-2; hRTEF-1B; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003213 edited
GTCCTCCTCGCACACTCGAGGCCAGGGGGCGGGAGGGCCGCAGCTCCGGCGCCGCCGCGT
CCCGCCAGAACGATCGCCGCGGCCGGAAGAGTTGGCGCTCGGGGCGGACTCCTTGGAACT
GGCTTAGCGCACCCATCCCACCTTCCCGCACCCTGGGACCGGTCCAACGAGCGCTCCTCC
AAGCGGAGCCTTGGAGGGCACGGCCGGCACCATTACCTCCAACGAGTGGAGCTCTCCCAC
CTCCCCTGAGGGGAGCACCGCCTCTGGGGGCAGTCAGGCACTGGACAAGCCCATCGACAA
TGACGCAGAGGGCGTGTGGAGCCCGGATATTGAGCAGAGTTTCCAGGAGGCCCTCGCCAT
CTACCCGCCCTGTGGCAGGCGCAAAATCATCCTGTCGGACGAGGGCAAGATGTATGGTCG
GAACGAGCTGATTGCCCGCTACATCAAGCTCCGGACAGGGAAGACCCGCACCAGGAAGCA
GGTCTCCAGCCACATCCAGGTGCTGGCTCGTCGCAAAGCTCGCGAGATCCAGGCCAAGCT
AAAGGACCAGGCAGCTAAGGACAAGGCCCTGCAGAGCATGGCTGCCATGTCGTCTGCACA
GATCATCTCCGCCACGGCCTTCCACAGTAGCATGGCCCTCGCCCGGGGCCCCGGCCGCCC
AGCAGTCTCAGGGTTTTGGCAAGGAGCTTTGCCAGGCCAAGCCGGAACGTCCCATGATGT
GAAGCCTTTCTCTCAGCAAACCTATGCTGTCCAGCCTCCGCTGCCTCTGCCAGGGTTTGA
GTCTCCTGCAGGGCCCGCCCCATCGCCCTCTGCGCCCCCGGCACCCCCATGGCAGGGCCG
CAGCGTGGCCAGCTCCAAGCTCTGGATGTTGGAGTTCTCTGCCTTCCTGGAGCAGCAGCA
GGACCCGGACACGTACAACAAGCACCTGTTCGTGCACATTGGCCAGTCCAGCCCAAGCTA
CAGCGACCCCTACCTCGAAGCCGTGGACATCCGCCAAATCTATGACAAATTCCCGGAGAA
AAAGGGTGGACTCAAGGATCTCTTCGAACGGGGACCCTCCAATGCCTTTTTTCTTGTGAA
GTTCTGGGCAGACCTCAACACCAACATCGAGGATGAAGGCAGCTCCTTCTATGGGGTCTC
CAGCCAGTATGAGAGCCCCGAGAACATGATCATCACCTGCTCCACGAAGGTCTGCTCTTT
CGGCAAGCAGGTGGTGGAGAAAGTTGAGACAGAGTATGCTCGCTATGAGAATGGACACTA
CTCTTACCGCATCCACCGGTCCCCGCTCTGTGAGTACATGATCAACTTCATCCACAAGCT
CAAGCACCTCCCTGAGAAGTACATGATGAACAGCGTGCTGGAGAACTTCACCATCCTGCA
GGTGGTCACCAACAGAGACACACAGGAGACCTTGCTGTGCATTGCCTATGTCTTTGAGGT
GTCAGCCAGTGAGCACGGGGCTCAGCACCACATCTACAGGCTGGTGAAAGAATGAGAGAC
TCGGGGAGCAGGGAGGGGGGAAGAGACGTGTGTGCAGGAAACGGGGACGTGGGGAGGGGA
CCTGCAGGGGCAGCCCCCTGAAGTGCCAAGAGAGCTGAGAGGAGCAGTTGTGACTCTACC
CAGGAACAAACTGTGCCTGAACCTGAGGTGCCCAACCCCAAATAAACCCAAGATGCTGTG
TATTTTCAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI |
ACCN NM_003213
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003213.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003213.2, NP_003204.2
RefSeq Size 1780 bp
RefSeq ORF 1305 bp
Locus ID 7004
UniProt ID Q15561
Cytogenetics 12p13.33
Domains TEA
Protein Families Transcription Factors
Summary This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longest isoform (1), and initiates translation from a non-AUG (UUG) codon.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003213" in other vectors (6)
SKU Description Size Price
RC219686 TEAD4 (Myc-DDK-tagged)-Human TEA domain family member 4 (TEAD4), transcript variant 1 10 ug
$686.00
RC219686L1 Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC219686L2 Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 1, mGFP tagged 10 ug
$986.00
RC219686L3 Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC219686L4 Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 1, mGFP tagged 10 ug
$986.00
RG219686 TEAD4 (tGFP-tagged) - Human TEA domain family member 4 (TEAD4), transcript variant 1 10 ug
$489.00 $886.00

file-alt Citations

In vitro screening and toxic mechanism exploring of leading components with potential hepatotoxicity of Herba Epimedii extracts
Zhang, Xu, Yang et al
Toxicol In Vitro (2020) 62, 104660 DOI: 10.1016/j.tiv.2019.104660
Cited by 23
AI Summary: In this study, OriGene’s GAPDH (TA-08) and β-actin (TA-09) antibodies were used as internal controls in Western blot analyses to assess protein expression changes related to hepatotoxicity mechanisms induced by Herba Epimedii extracts.
TEA Domain Transcription Factor 4 Is the Major Mediator of Yes-Associated Protein Oncogenic Activity in Mouse and Human Hepatoblastoma
Zhang, Liu, Tao et al
Am. J. Pathol. (2019) 189 (5), 1077-1090 DOI: 10.1016/j.ajpath.2019.01.016
AI Summary: OriGene’s TEAD4 (pCMV6-Neo plasmid, #SC111037) construct was used for transient transfection experiments in HepG2 and Hep293TT cell lines to investigate the role of TEAD4 in hepatoblastoma growth and YAP-mediated oncogenic activity.
Snippet: Transient transfection experiments with TEAD2VP16 and TEAD4 (in pCMV6-Neo plasmid;Origene Technologies Inc., Rockville, MD;number SC111037) constructs were conducted in HepG2 and Hep293TT cell lines using the Lipofectamine 2000 Reagent (Thermo;;- Transient transfection experiments with TEAD2VP16 and TEAD4 (in pCMV6-Neo plasmid;#SC111037) constructs were conducted in HepG2 and Hep293TT cell lines using the Lipofectamine 2000 Reagent (ThermoFisher
Targeting TEAD/YAP-transcription-dependent necrosis, TRIAD, ameliorates Huntington's disease pathology
Mao, Chen, Xu et al
Hum Mol Genet (2016) 25 (21), 4749-4770 DOI: 10.1093/hmg/ddw303
Cited by 50
AI Summary: OriGene products, specifically the pCMV6-Myc-DDK-YAP1 plasmid and shRNA constructs targeting YAP1, were used in this study to manipulate YAP1 expression in cellular models, enabling the authors to investigate the role of TEAD/YAP-dependent transcription in Huntington’s disease-associated neuronal necrosis.
Targeting TEAD/YAP-transcription-dependent necrosis, TRIAD, ameliorates Huntington's disease pathology
Mao, Chen, Xu et al
Hum. Mol. Genet. (2016)
Cited by 50
AI Summary: OriGene products contributed to this study by providing human TEAD1 (Cat. #SC112830), TEAD2 (Cat. #SC320274), TEAD3 (Cat. #SC313452), and TEAD4 (Cat. #SC111037) cDNA expression vectors, which were used to investigate the role of TEAD/YAP-dependent transcription in Huntington's disease pathology.
Snippet: The expression vectors were pCI-FL-YAP, pCI-YAP∆C (5), human TEAD1 (Origene, MD, USA, Cat. #SC112830), TEAD2 (Origene, MD, USA, Cat. #SC320274), TEAD3 (Origene, MD, USA, Cat. #SC313452), TEAD4 (Origene, MD, USA, Cat. #SC111037) cDNA, pcDNA-HA-p73alpha (81)
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products