OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Superoxide Dismutase 1 (SOD1) (NM_000454) Human Untagged Clone

Be the first to review this product
SKU
SC111022
SOD1 (untagged)-Human superoxide dismutase 1, soluble (SOD1)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA500495 SOD1 (Superoxide Dismutase 1) mouse monoclonal antibody, clone OTI8B10 (formerly 8B10) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Superoxide Dismutase 1 or NM_000454"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Superoxide Dismutase 1
Synonyms ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD; STAHP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111022 sequence for NM_000454 edited (data generated by NextGen Sequencing)
ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT
TTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT
GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGT
GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGG
CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT
GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTC
CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC
GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA

Clone variation with respect to NM_000454.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000454 unedited
ACCGGTTTTGAAACCGACTCATATAGGCGGCAACCAATTCGCACGAGGTGCTGGTTTGCG
TCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCG
TGGCCTATCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGC
AGGGCATCATCAATTTCGAGCAGAATGTTTTTTATGGACCAGTGAAGGTGTGGGGAAGCA
TTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAG
CAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAA
AGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGG
CCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCC
GCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTA
CAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAA
CATTCCCTTGGATGTAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAA
ATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGTAATTGTGTGACTTTTTCA
GAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTTGGAAGATCTGTAT
AGNTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCACGACTTAA
TCACAGATGGGTATTAAACCTGTCAGAATTTCTTGTCATTCAAGCCTTGAATAAAAAACC
TGTATGGCACTTTTAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000454 unedited
GTCTGCCCGCGGCCGCATCTAGGTCGGCTTTTTTTTTTTTTTTTTGAATTTGGATTCTTT
TAATAGCCTCATAATAAGTGCCATACAGGGTTTTTATTCACAGGCTTGAATGACAAAGAA
ATTCTGACAAGTTTAATACCCATCTGTGATTTAAGTCTGGCAAAATACAGGTCATTGAAA
CAGACATTTTAACTGAGTTTTATAAAACTATACAAATCTTCCAAGTGATCATAAATCAGT
TTCTCACTACAGGTACTTTAAAGCAACTCTGAAAAAGTCACACAATTACACTTTTAAGAT
TACAGTGTTTAATGTTTATCAGGATACATTTCTACAGCTAGCAGGATAACAGATGAGTTA
AGGGGCCTCAGACTACCTCCACGGGAATGTTTATCGGGCGATCCCAATTACACCACAAGC
CAAACGACTTCCAGCGTTTCCTGTCTTTGCACTTTCTTCATTTTCACCTTTGCCCAAGTC
ATCTGCTTTTTCATGGACCACCAGTGTGCGGCCAATGATGCAATGGTCTCCTGAGAGTGA
GATCACAGAATCTTCACTAGACACATCGGCCACACCATCTTTGTCAGCAGCCACATTGCC
CAAGTCTCCAACATGCCTCTNTTTATCCTTTGGCCCACCGTGTTTTCTGGATAGAGGATC
AAAGTGATGACCCTGTCCTGTCACCGCCTGCTGTATTATCTCCAAACTCATGAACATGGC
ATCCACTGCGGCCCTAACTCACCTCTTTAATGCTTCCCCAACCCTTACTGGCCATTCACT
TCCTTTTTGCTCGACAATGATGAATGCCCTGCCCTGAGCCCGTCGTCCTTTTTCCCCCCC
AACGCACTTTGTTCCCCTCACCTCCGTTTAGCCCCGCCCCAGTTCCTGGCTTCCAGGGAC
TGCAACCGAAACCCCACAACCCTGGAGGAGAATACGAGCCAAACCATATACCGCCGCGCG
CATTCCCG
Restriction Sites NotI-NotI |
ACCN NM_000454
Insert Size 940 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000454.4, NP_000445.1
RefSeq Size 981 bp
RefSeq ORF 465 bp
Locus ID 6647
UniProt ID P00441
Cytogenetics 21q22.11
Domains sodcu
Protein Families Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS), Huntington's disease, Prion diseases
Summary The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. In addition, this protein contains an antimicrobial peptide that displays antibacterial, antifungal, and anti-MRSA activity against E. coli, E. faecalis, S. aureus, S. aureus MRSA LPV+, S. agalactiae, and yeast C. krusei. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. provided by RefSeq, Jul 2020
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000454" in other vectors (6)
SKU Description Size Price
RC200725 SOD1 (Myc-DDK-tagged)-Human superoxide dismutase 1, soluble (SOD1) 10 ug
$225.00
RC200725L1 Lenti ORF clone of Human superoxide dismutase 1, soluble (SOD1), Myc-DDK-tagged 10 ug
$525.00
RC200725L2 Lenti ORF clone of Human superoxide dismutase 1, soluble (SOD1), mGFP tagged 10 ug
$525.00
RC200725L3 Lenti ORF clone of Human superoxide dismutase 1, soluble (SOD1), Myc-DDK-tagged 10 ug
$525.00
RC200725L4 Lenti ORF clone of Human superoxide dismutase 1, soluble (SOD1), mGFP tagged 10 ug
$525.00
RG200725 SOD1 (tGFP-tagged) - Human superoxide dismutase 1, soluble (SOD1) 10 ug
$425.00

file-alt Citations

Glycation in Demetalated Superoxide Dismutase 1 Prevents Amyloid Aggregation and Produces Cytotoxic Ages Adducts
Sirangelo, Vella, Irace et al
Front Mol Biosci (2016) 3, 55 DOI: 10.3389/fmolb.2016.00055
Cited by 33
AI Summary: OriGene contributed to this study by providing the cDNA encoding human intracellular CuZnSOD (Superoxide Dismutase 1), which was used for cloning and subsequent experiments investigating glycation and amyloid aggregation.
Snippet: Cloning cDNA encoding the human intracellular CuZnSOD was purchased by OriGene (USA) and inserted in the pETDuet-1 vector (Novagen) by PCR using oligonucleotides that introduce BamHI site at the initiation codon and NotI site downstream of the stop codon ... Cite SaveSaving
Nanoluciferase signal brightness using furimazine substrates opens bioluminescence resonance energy transfer to widefield microscopy
Kim, Grailhe
Cytometry A (2016)
Cited by 24
AI Summary: OriGene contributed the SOD1 cDNA plasmid (catalog no. SC111022), which was used as a template for amplifying SOD1 in the study's plasmid preparations.
Snippet: Plasmid Preparation. SOD1, Nluc and Rluc, were amplified from the SOD1 cDNA plasmid (Origene, Abingdon, UK, catalog no. SC111022), the pNL1.1 and pRL-null plasmid (Promega, Madison, WI), respectively. All constructions ... Cite SaveSaving
Dimerization, oligomerization, and aggregation of human Amyotrophic lateral sclerosis Cu/Zn-superoxide dismutase 1 mutant forms in live cells
Kim, Lee, Lee et al
J. Biol. Chem. (2014)
AI Summary: OriGene’s human superoxide dismutase 1 (SOD1) cDNA (SC111022) was used as the source for cloning SOD1 constructs, enabling the study of wild-type and mutant SOD1 dimerization and aggregation in live cells.
Snippet: EXPERIMENTAL PROCEDURES Plasmid constructs Human superoxide dismutase 1 (sod1) cDNA (Origene, Abingdon, UK SC111022) was cloned into the mammalian expression vectors pEYFP-C1/N1 and pECFP-C1/N1 (Clontech, BD Biosciences). ... Cite SaveSaving
NADPH oxidase activation is required in reactive oxygen species generation and cell transformation induced by hexavalent chromium
Wang, Son, Chang et al
Toxicol. Sci. (2011) 123 (2), 399-410 DOI: 10.1093/toxsci/kfr180
Cited by 114
AI Summary: OriGene contributed to this study by providing plasmid DNA encoding human SOD1, SOD2, and catalase, which were used to assess the effects of antioxidant enzyme overexpression on Cr(VI)-induced ROS generation and cell transformation.
Snippet: NOX1 small interfering RNA (h) and NOX3-siRNA (h) were purchased from Santa Cruz. Plasmids DNA encoding human SOD1, SOD2, and catalase were purchased from Origene (Rockville, MD). Cell lines and cell culture.
Proteomic analysis identifies oxidative stress induction by adaphostin
Stockwin, Bumke, Yu et al
Clin Cancer Res (2007) 13 (12), 3667-81 DOI: 10.1158/1078-0432.CCR-07-0025
AI Summary: In this study, OriGene’s SOD1 cDNA (OriGene, SC31906) was used for transfection experiments to confirm the role of superoxide dismutase (SOD1) in mediating resistance to adaphostin-induced oxidative stress in leukemia cells.
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products