OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAT2B (NM_182796) Human Untagged Clone

Be the first to review this product
SKU
SC110398
MAT2B (untagged)-Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA311407 Goat Anti-MAT2B (isoform 1) Antibody
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MAT2B or NM_182796"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAT2B
Synonyms MAT-II; MATIIbeta; Nbla02999; SDR23E1; TGR
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_182796, the custom clone sequence may differ by one or more nucleotides


ATGCCTGAAATGCCAGAGGACATGGAGCAGGAGGAAGTTAACATCCCTAATAGGAGGGTTCTGGTTACTG
GTGCCACTGGGCTTCTTGGCAGAGCTGTACACAAAGAATTTCAGCAGAATAATTGGCATGCAGTTGGCTG
TGGTTTCAGAAGAGCAAGACCAAAATTTGAACAGGTTAATCTGTTGGATTCTAATGCAGTTCATCACATC
ATTCATGATTTTCAGCCCCATGTTATAGTACATTGTGCAGCAGAGAGAAGACCAGATGTTGTAGAAAATC
AGCCAGATGCTGCCTCTCAACTTAATGTGGATGCTTCTGGGAATTTAGCAAAGGAAGCAGCTGCTGTTGG
AGCATTTCTCATCTACATTAGCTCAGATTATGTATTTGATGGAACAAATCCACCTTACAGAGAGGAAGAC
ATACCAGCTCCCCTAAATTTGTATGGCAAAACAAAATTAGATGGAGAAAAGGCTGTCCTGGAGAACAATC
TAGGAGCTGCTGTTTTGAGGATTCCTATTCTGTATGGGGAAGTTGAAAAGCTCGAAGAAAGTGCTGTGAC
TGTTATGTTTGATAAAGTGCAGTTCAGCAACAAGTCAGCAAACATGGATCACTGGCAGCAGAGGTTCCCC
ACACATGTCAAAGATGTGGCCACTGTGTGCCGGCAGCTAGCAGAGAAGAGAATGCTGGATCCATCAATTA
AGGGAACCTTTCACTGGTCTGGCAATGAACAGATGACTAAGTATGAAATGGCATGTGCAATTGCAGATGC
CTTCAACCTCCCCAGCAGTCACTTAAGACCTATTACTGACAGCCCTGTCCTAGGAGCACAACGTCCGAGA
AATGCTCAGCTTGACTGCTCCAAATTGGAGACCTTGGGCATTGGCCAACGAACACCATTTCGAATTGGAA
TCAAAGAATCACTTTGGCCTTTCCTCATTGACAAGAGATGGAGACAAACGGTCTTTCATTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_182796 unedited
GGCGTCCAGATTTTGTATACGACTCACTATAGGCGGCCGCGAAATTCGCACGAGCTGCTC
CTCACGTTTTGGCGTGCCTGCGCTCTCTGCAGGCAGAAGCGAACAAAGACCCAGCAAGAG
AAGGCAGAGGCTAAGACCCATCCCGTATCTGCTCTCCTGAAATAATTCTGGAGTCATGCC
TGAAATGCCAGAGGACATGGAGCAGGAGGAAGTTAACATCCCTAATAGGAGGGTTCTGGT
TACTGGTGCCACTGGGCTTCTTGGCAGAGCTGTACACAAAGAATTTCAGCAGAATAATTG
GCATGCAGTTGGCTGTGGTTTCAGAAGAGCAAGACCAAAATTTGAACAGGTTAATCTGTT
GGATTCTAATGCAGTTCATCACATCATTCATGATTTTCAGCCCCATGTTATAGTACATTG
TGCAGCAGAGAGAAGACCAGATGTTGTAGAAAATCAGCCAGATGCTGCCTCTCAACTTAA
TGTGGATGCTTCTGGGAATTTAGCAAAGGAAGCAGCTGCTGTTGGAGCATTTCTCATCTA
CATTAGCTCAGATTATGTATTTGATGGAACAAATCCACCTTACAGAGAGGAAGACATACC
AGCTCCCCTAAATTTGTATGGCAAAACAAAATTAGATGGAGAAAAGGCTGTCCTGGAGAA
CAATCTGGGAGCTGCTGTTTTGAGGATTCCTATTCTGTATGGNNNGAAGTGAAAAGCTCG
AAGAAAGTGCTGTGACTGTTATGTTTGATAAAGTGCAGTTCAGCAACAAGTCAGCAAACA
TGGATCACTGGCAGCAGAAGTTCCCCACACATGTCAAAGATGTGGCCACTGTGTGCNCGC
AGCTAGCAGAGAAGAGAATGCTGGATCCATCAATTAGGGAACCTTCACTGGTCTGGCATG
AACAGAGACTAAC
Restriction Sites NotI-NotI |
ACCN NM_182796
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182796.1, NP_877725.1
RefSeq Size 2119 bp
RefSeq ORF 972 bp
Locus ID 27430
UniProt ID Q9NZL9
Cytogenetics 5q34
Protein Pathways Cysteine and methionine metabolism, Metabolic pathways, Selenoamino acid metabolism
Summary The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Nov 2012
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region but maintains the reading frame, compared to variant 1. These differences result in a shorter isoform (2) with a distinct N-terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_182796" in other vectors (5)
SKU Description Size Price
RC202680 MAT2B (Myc-DDK-tagged)-Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2 10 ug
$300.00
RC202680L3 Lenti ORF clone of Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC202680L4 Lenti ORF clone of Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2, mGFP tagged 10 ug
$600.00
RG202680 MAT2B (tGFP-tagged) - Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2 10 ug
$489.00 $500.00
SC324574 MAT2B (untagged)-Human methionine adenosyltransferase II, beta (MAT2B), transcript variant 2 10 ug
$300.00

file-alt Citations

Methionine adenosyltransferase 2A/2B and methylation: gene sequence variation and functional genomics
Nordgren, Peng, Pelleymounter et al
Drug Metab. Dispos. (2011) 39 (11), 2135-47 DOI: 10.1124/dmd.111.040857
Cited by 27
AI Summary: OriGene products contributed to this study by providing the MAT2A (SC116444), MAT2B V1 (SC110397), and MAT2B V2 (SC110398) clones, which were used as templates to amplify open reading frames for functional genomic analyses.
Snippet: The open reading frames (ORFs) of MAT2A, MAT2B V1, and MAT2B V2 were amplified from Origene clones SC116444, SC110397, and SC110398 (Origene, Rockville, MD), respectively, and each amplicon was subcloned into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products