OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

POLR1D (NM_015972) Human Untagged Clone

Be the first to review this product
SKU
SC108711
POLR1D (untagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA366094 POLR1D rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "POLR1D or NM_015972"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol POLR1D
Synonyms AC19; POLR1C; RPA9; RPA16; RPAC2; RPC16; RPO1-3; TCS2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_015972, the custom clone sequence may differ by one or more nucleotides


ATGGAAGAGGATCAGGAGCTGGAGAGAAAAATATCTGGATTGAAGACCTCAATGGCTGAAGGCGAGAGGA
AGACAGCCCTGGAAATGGTCCAGGCAGCTGGAACAGATAGACACTGTGTGACATTTGTATTGCACGAGGA
AGACCATACCCTAGGAAATTCTCTACGTTACATGATCATGAAGAACCCGGAAGTGGAATTTTGTGGTTAC
ACTACGACCCATCCTTCAGAGAGCAAAATTAATTTACGCATTCAGACTCGAGGTACCCTTCCAGCTGTTG
AGCCATTTCAGAGAGGCCTGAATGAGCTCATGAATGTCTGCCAACATGTGCTTGACAAGTTTGAGGCCAG
CATAAAGGACTATAAGGATCAAAAAGCAAGCAGAAATGAATCCACATTCTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_015972 unedited
GTCAGATTTGTATACGACTTCTATAGGCGGCCGCGCAATTCGCACGAGGTTCCGTCGGTC
GGTCCTTGCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGC
CAGCACCACCTGAGGATCCAGAAACCGCCCCAGCGATGGAAGAGGATCAGGAGCTGGAGA
GGAAAGCAATAGAAGAACTGCTTAAGGAGGCAAAACGTGGGAAAACTAGAGCTGAAACAA
TGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCTAGCACCAATAAAAGATTTCTAATTA
ACACAATTAAAAACACATTGCCCTCTCATAAAGAGCAAGACCATGAACAAAAAGAGGGCG
ATAAGGAACCAGCCAAGAGCCAGGCCCAGAAAGAAGAAAACCCAAAGAAACACAGAAGCC
ATCCTTACAAGCACAGCTTCCGCGCTCGAGGTTCCGCCAGTTACTCCCCGCCACGAAAGC
GGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAACCGGCGGTGAGGCTGGAACCAGGGCC
AGCCAGCCCTGCGGGCCTCCGTGCTCCTTCGGGGTGCGGTGTGCGGAGAAGGCCTGAGCT
GGCAGGGCAAACACCTGAGAGTGACTTTGACATTAGGTCCTTTGTTGTTTTTAAAGAGGC
TGCTGCCCACAGGCAAAAAAAATGACCTAGCAACTCTTGAGGAAACAAGTGCAAAGGGAG
ATGTCTTGGCAAGTTTAAGCTACTTCTGCAGTGTAGTAGACTTACATATTGNTGNTTATC
TTGGTTGGAGTGTGTTTAAAATAAACTGTCTAGAATTAAAAGTTTCAGAGATTGGTAAAC
CTGGTCCCAATTTTTGGTCATTTCTCAGAAAATAAATACCTATAATCCTTATTTTACTTT
TGGGGGTATTACATTAAA
Restriction Sites NotI-NotI |
ACCN NM_015972
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015972.1, NP_057056.1
RefSeq Size 726 bp
RefSeq ORF 402 bp
Locus ID 51082
UniProt ID P0DPB6
Cytogenetics 13q12.2
Domains RNA_pol_L
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Summary The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2011
Transcript Variant: This variant (1) represents the shortest transcript but encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_015972" in other vectors (7)
SKU Description Size Price
RC201466 POLR1D (Myc-DDK-tagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 10 ug
$150.00
RC201466L1 Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC201466L2 Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, mGFP tagged 10 ug
$450.00
RC201466L3 Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC201466L4 Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, mGFP tagged 10 ug
$450.00
RG201466 POLR1D (tGFP-tagged) - Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 10 ug
$489.00
SC322230 POLR1D (untagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 10 ug
$150.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products