OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

YTHDF3 (NM_152758) Human Untagged Clone

Be the first to review this product
SKU
SC100822
YTHDF3 (untagged)-Human YTH domain family, member 3 (YTHDF3)
  $818.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA383420 YTHDF3 Rabbit polyclonal Antibody
100 ul
$410.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "YTHDF3 or NM_152758"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol YTHDF3
Synonyms DF3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_152758, the custom clone sequence may differ by one or more nucleotides


ATGTCAGCCACTAGCGTGGATCAGAGACCTAAAGGGCAAGGAAATAAAGTTTCAGTACAAAACGGTTCGA
TTCATCAAAAAGATGCTGTAAATGATGATGATTTTGAGCCATACTTAAGTAGCCAGACAAATCAGAGTAA
CAGCTATCCACCAATGTCAGATCCATACATGCCTAGTTACTATGCTCCATCCATTGGATTTCCATATTCT
CTTGGGGAAGCAGCGTGGTCCACAGCTGGAGACCAGCCTATGCCATATCTGACAACCTATGGACAAATGA
GTAATGGAGAACATCACTATATACCAGATGGTGTATTTAGTCAACCTGGGGCATTAGGAAATACCCCTCC
ATTTCTTGGTCAACATGGATTTAACTTTTTTCCTGGTAATGCTGATTTCTCTACATGGGGGACAAGTGGA
TCTCAGGGACAATCAACACAAAGTTCTGCTTATAGTAGCAGTTATGGCTATCCACCTAGTTCTCTTGGGA
GAGCTATTACTGATGGACAGGCTGGATTTGGCAATGATACTTTGAGTAAGGTGCCTGGCATTAGCAGTAT
TGAGCAAGGCATGACTGGACTGAAAATTGGTGGTGACCTGACAGCTGCAGTGACAAAAACTGTAGGTACA
GCTTTGAGCAGCAGTGGTATGACTAGCATTGCAACCAATAGTGTGCCCCCAGTTAGCAGTGCAGCACCTA
AACCAACCTCCTGGGCTGCCATTGCCAGAAAGCCTGCCAAACCTCAACCGAAACTTAAACCCAAGGGCAA
TGTGGGAATTGGGGGTTCTGCTGTACCACCACCTCCTATAAAACACAACATGAATATTGGAACTTGGGAT
GAAAAAGGGTCAGTGGTAAAGGCTCCACCAACCCAACCAGTTCTGCCTCCTCAAACTATAATCCAGCAGC
CTCAGCCATTAATTCAACCACCACCATTGGTGCAAAGCCAACTGCCTCAACAGCAGCCTCAACCACCACA
ACCACAGCAGCAACAAGGACCTCAGCCACAGGCCCAGCCTCACCAAGTGCAGCCTCAACAGCAGCAGCTG
CAGAATCGCTGGGTAGCTCCTCGTAACAGGGGAGCAGGCTTCAACCAGAACAATGGAGCGGGCAGTGAAA
ACTTTGGTTTAGGTGTTGTACCTGTCAGTGCTTCACCTTCTAGTGTAGAAGTGCATCCCGTGCTGGAAAA
GCTAAAGGCCATAAACAACTATAATCCCAAAGACTTTGATTGGAATCTGAAGAATGGACGTGTGTTTATA
ATTAAAAGCTACTCTGAGGATGACATACATCGTTCCATTAAATACTCTATCTGGTGTAGTACTGAGCATG
GTAATAAGCGTTTGGATGCAGCTTACCGTTCCCTGAATGGGAAAGGCCCACTCTATTTACTCTTCAGTGT
GAATGGCAGTGGACATTTTTGTGGAGTGGCTGAAATGAAGTCTGTTGTGGACTATAATGCGTATGCTGGT
GTCTGGTCTCAGGATAAGTGGAAGGGCAAATTTGAAGTTAAATGGATCTTTGTCAAAGATGTTCCCAATA
ACCAATTACGGCATATTCGCTTAGAAAATAATGACAACAAACCGGTTACCAATTCAAGGGACACTCAAGA
GGTACCCCTAGAAAAAGCTAAGCAAGTGCTTAAAATAATTGCTACTTTCAAGCATACCACCTCAATCTTT
GATGACTTTGCACATTATGAAAAGCGTCAAGAAGAGGAGGAAGCCATGCGTAGGGAGAGAAATAGAAACA
AACAATAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites NotI-NotI |
ACCN NM_152758
Insert Size 4700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152758.3, NP_689971.3
RefSeq Size 5171 bp
RefSeq ORF 1758 bp
Locus ID 253943
UniProt ID Q7Z739
Cytogenetics 8q12.3
Domains YTH
Summary This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2013
Transcript Variant: This variant (1) encodes isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_152758" in other vectors (6)
SKU Description Size Price
RC208423 YTHDF3 (Myc-DDK-tagged)-Human YTH domain family, member 3 (YTHDF3) 10 ug
$817.00
RC208423L1 Lenti ORF clone of Human YTH domain family, member 3 (YTHDF3), Myc-DDK-tagged 10 ug
$1,117.00
RC208423L2 Lenti ORF clone of Human YTH domain family, member 3 (YTHDF3), mGFP tagged 10 ug
$1,117.00
RC208423L3 Lenti ORF clone of Human YTH domain family, member 3 (YTHDF3), Myc-DDK-tagged 10 ug
$1,117.00
RC208423L4 Lenti ORF clone of Human YTH domain family, member 3 (YTHDF3), mGFP tagged 10 ug
$1,117.00
RG208423 YTHDF3 (tGFP-tagged) - Human YTH domain family, member 3 (YTHDF3) 10 ug
$1,017.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products