HDAC7 (NM_015401) Human Tagged ORF Clone
- TrueORF®
SKU
RC215233
HDAC7 (Myc-DDK-tagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1
$1,451.00
In Stock*
Specifications
| Product Data | |
| Type | Human Tagged ORF Clone |
|---|---|
| Target Symbol | HDAC7 |
| Synonyms | HD7; HD7A; HDAC7A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_015401 |
| ORF Size | 2973 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_015401.5 |
| RefSeq Size | 4301 bp |
| RefSeq ORF | 2976 bp |
| Locus ID | 51564 |
| UniProt ID | Q8WUI4 |
| Cytogenetics | 12q13.11 |
| Domains | Hist_deacetyl |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 106.6 kDa |
| Summary | Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_015401" in other vectors (7)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC215233L1 | Lenti-ORF clone of HDAC7 (Myc-DDK-tagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,751.00
|
|
| RC215233L2 | Lenti-ORF clone of HDAC7 (mGFP-tagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,751.00
|
|
| RC215233L3 | Lenti-ORF clone of HDAC7 (Myc-DDK-tagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,751.00
|
|
| RC215233L4 | Lenti-ORF clone of HDAC7 (mGFP-tagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,751.00
|
|
| RG215233 | HDAC7 (tGFP-tagged) - Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,651.00
|
|
| SC112645 | HDAC7 (untagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,308.00
|
|
| SC318433 | HDAC7 (untagged)-Human histone deacetylase 7 (HDAC7), transcript variant 1 | 10 ug |
$1,453.00
|
|
Citations
Alternative splicing of HDAC7 regulates its interaction with 14-3-3 proteins to alter histone marks and target gene expression
Agosto, Mallory, Ferretti et al
Cell Rep (2023) 42 (3), 112273 DOI: 10.1016/j.celrep.2023.112273
Agosto, Mallory, Ferretti et al
Cell Rep (2023) 42 (3), 112273 DOI: 10.1016/j.celrep.2023.112273
Cited by 13
AI Summary: OriGene contributed to this study by providing the human HDAC7 (NM_015401) ORF cDNA clone (#RC215233), which was used for exogenous expression experiments to investigate the role of HDAC7 alternative splicing in T cell gene regulation.
Snippet: GAGCGCCTGCCATAGGGAGCAGGGCGAGGGTCACCGGTCCCAGACCTCTACCCCGGCGCACCTTCCCCAGAACACCC. For exogenous HDAC7 cDNA expression, the HDAC7 (NM_015401) human ORF cDNA (991 amino acids, 1MHSPGADGTQ;purchased from Origene, Rockville, MD, USA;#RC215233) was cloned into the pEFnFlag and pDoxnFlag vectors with a 5′-GGATCT-3′ spacer.32 We further engineered the plasmids by deleting the first 39 amino acids to
Effects of acupuncture on regulating the hippocampal inflammatory response in rats exposed to post-traumatic stress disorder
Jiang, Chen, Li et al
Neurosci Lett (2023) 796, 137056 DOI: 10.1016/j.neulet.2023.137056
Jiang, Chen, Li et al
Neurosci Lett (2023) 796, 137056 DOI: 10.1016/j.neulet.2023.137056
Cited by 3
AI Summary: In this study, OriGene’s IL-6 (Cat# SEKR-0072) and IL-1β (Cat# SEKR-0002) ELISA kits were used to measure serum cytokine levels, helping to assess the effects of acupuncture on inflammatory responses in a rat model of PTSD.
Salt-inducible kinase 1 maintains HDAC7 stability to promote pathologic cardiac remodeling
Hsu, Duan, McMahon et al
J. Clin. Invest. (2020)
Hsu, Duan, McMahon et al
J. Clin. Invest. (2020)
AI Summary: OriGene’s recombinant HDAC7 protein was used in kinase assays to investigate the phosphorylation and stabilization of HDAC7 by SIK1, elucidating their role in pathologic cardiac remodeling.
Snippet: 10ng of recombinant SIK1 (Thermo Fisher) and 100ng of recombinant HDAC7 (Origene) were 545 incubated in a final volume of 40uL containing 1X kinase buffer (CST) supplemented with 100uM 546 ATP. 1uM of YKL-05-099 was added for inhibition of SIK1 activity. Reactions were incubated for
Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
Witt, Lee, Lee et al
Oncogene (2016)
Witt, Lee, Lee et al
Oncogene (2016)
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
