OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cebpb (NM_009883) Mouse Tagged ORF Clone

  • TrueORF®
Be the first to review this product
SKU
MR227563
Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
DDK tGFP
Lentiviral Particles:
DDK mGFP DDK w/ Puro mGFP w/ Puro
AAV Particle:
DDK
$289.00 $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (5)

TA592569S DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
30 ul
$200.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
PS100001 pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
10 ug
$670.00
AR100028M DDKTrap Anti-DDK 8G6 affinity resin used for the purification of DDK, DYKDDDDK, or FLAG® tagged proteins , 5 mL
5 ml
$750.00

Other products for "Cebpb or NM_009883"

Specifications
Specifications
Product Data
Type Mouse Tagged ORF Clone
Target Symbol Cebpb
Synonyms C/EBPbeta; CRP2; IL-6DBP; LAP; LIP; NF-IL6; NF-M; Nfil6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>MR227563 representing NM_009883
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCACCGCCTGCTGGCCTGGGACGCAGCATGCCTCCCGCCGCCGCCCGCCGCCTTTAGACCCATGGAAG
TGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGCCGCGCGC
CCCCGCCGCCGAGCCGGCCATTGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGAGCCGCTC
GCGCCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTCTCCGACCTCTTCGCCGACG
ACTACGGCGCCAAGCCGAGCAAGAAGCCGGCCGACTACGGTTACGTGAGCCTCGGCCGCGCGGGCGCCAA
GGCCGCGCCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCGCTCAAGGCGGAGCCGGGCTTCGAACCC
GCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGTTTCCCGTTCGCCCTGCGCGCCTACC
TGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCAGCCCGCCCGG
CACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGCCGCGCCCGCC
AAGGCCAAGGCCAAGAAGACGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAGCGCAACAACA
TCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGGTGCTGGAGCT
GACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCACCCTGCGGAAC
TTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGCCACTGC

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI Cloning Scheme for this gene | Plasmid Map
ACCN NM_009883
ORF Size 888 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009883.4
RefSeq Size 1507 bp
RefSeq ORF 891 bp
Locus ID 12608
UniProt ID P28033
Cytogenetics 2 87.58 cM
MW 31.9 kDa
Summary Important transcription factor regulating the expression of genes involved in immune and inflammatory responses (PubMed:16585579, PubMed:17911624, PubMed:18486321, PubMed:20111005). Plays also a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis (PubMed:9727068, PubMed:10635333, PubMed:17301242, PubMed:17601773, PubMed:19478079, PubMed:24061474, PubMed:24216764). The consensus recognition site is 5'-TTGNNGNAATG-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant functions with CEBPA (PubMed:15509779). Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage (PubMed:9727068, PubMed:10635333, PubMed:16585579). Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Plays also a role in intracellular bacteria killing (PubMed:17911624). During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation (PubMed:15985551, PubMed:17301242, PubMed:17601773, PubMed:20194620). Essential for female reproduction because of a critical role in ovarian follicle development (PubMed:9303532). Restricts osteoclastogenesis (PubMed:19440205). Together with NFE2L1; represses expression of DSPP during odontoblast differentiation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009883" in other vectors (6)
SKU Description Size Price
MC208276 Cebpb (untagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), (10ug) 10 ug
$300.00
MG227563 Cebpb (tGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP) beta (Cebpb), (10ug) 10 ug
$500.00
MR227563L1 Lenti ORF clone of Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) 10 ug
$600.00
MR227563L2 Lenti ORF clone of Cebpb (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) 10 ug
$600.00
MR227563L3 Lenti ORF clone of Cebpb (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) 10 ug
$600.00
MR227563L4 Lenti ORF clone of Cebpb (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb) 10 ug
$600.00

Plasmid Map for MR227563

Download sequence for

file-download TXT (FASTA format)

file-download Genbank

Cloning scheme for MR227563
Circular map for MR227563

file-alt Citations

CEBPB Expression in Tumor Cells Drives Immune Evasion in Colorectal Cancer via CTLA4 Up-regulation in T Cells
Yun, Park, Yun et al
Cancer Commun (Lond) (2026) 46, 0013 DOI: 10.34133/cancomm.0013
Cited by 1
AI Summary: OriGene’s human CEBPB (SC319561) and mouse Cebpb (MR227563) cDNA products were used as templates for PCR amplification to generate constructs for functional studies investigating the role of CEBPB in immune evasion in colorectal cancer.
Snippet: yes">LCN2 from HEK293T and mouse Lcn2 from CT26 were generated by PCR amplification, cDNA was obtained from human CEBPB (SC319561, OriGene) and mouse Cebpb (MR227563, OriGene), open reading frame clones were cloned into entry vector pDONR221 (12536017, Thermo Fisher Scientific), and entry vector with
FigureFigureFigure
The transcription factors NR5A1 and JUNB cooperate to activate the Axl promoter in mouse Sertoli cell lines
Diawara, Martin
Mol Biol Rep (2024) 51 (1), 982 DOI: 10.1007/s11033-024-09934-3
AI Summary: OriGene contributed to this study by providing the mouse CEBPB expression vector (Cat #: MR227563), which was used to investigate transcriptional regulation in Sertoli cells.
Snippet: … All promoter/reporter plasmid constructs were confirmed by SANGER sequencing. The mouse CEBPB expression vector (Cat #: MR227563) was purchased from OriGene (OriGene Technologies, Inc., Rockville, MD, USA). …
The transcription factors Creb1 and CEBPB regulate Sox9 promoter activity in TM4 Sertoli cells
Diawara, Arsenault, Charette et al
Gene (2023) 873, 147477 DOI: 10.1016/j.gene.2023.147477
Cited by 8
AI Summary: OriGene products contributed to this study by providing the mouse Cebpb (Cat #: MR227563) and Creb1 (Cat #: MR204788) expression vectors, which were used to investigate the regulatory roles of these transcription factors on Sox9 promoter activity in TM4 Sertoli cells.
Snippet: The expression vectors for mouse Cebpb (Cat #: MR227563) and Creb1 (Cat #: MR204788) were purchased from OriGene (OriGene Technologies, Inc., Rockville, MD, USA)
Ubiquitin Ligase COP1 Suppresses Neuroinflammation by Degrading c/EBPβ in Microglia
Ndoja, Reja, Lee et al
Cell (2020) 182 (5), 1156-1169.e12 DOI: 10.1016/j.cell.2020.07.011
Cited by 164
AI Summary: In this study, OriGene's c/EBPβ expression plasmid (Cat# RC206307) and COP1 shRNA plasmid (Cat# TG319374) were used to manipulate gene expression in microglia, enabling the authors to investigate how COP1 regulates c/EBPβ levels and suppresses neuroinflammation.
Protein S-glutathionylation stimulate adipogenesis by stabilizing C/EBPβ in 3T3L1 cells
Watanabe, Watanabe, Fujioka et al
FASEB J. (2020)
AI Summary: OriGene products, including the Myc-FLAG-tagged mouse C/EBPβ plasmid (MR227563), Myc-FLAG-tagged mouse PIAS1 plasmid (MR209770), and C-terminal HA-tag vector (PS100004), were used to express and study the roles of C/EBPβ and PIAS1 in the investigation of protein S-glutathionylation during adipogenesis.
Snippet: Cambridge, UK). Myc‐FLAG‐tagged mouse C/EBPβ plasmid (MR227563), Myc ‐FLAG‐tagged mouse PIAS1 plasmid (MR209770), and C‐terminal HA‐tag vector (PS100004) were from Origene (Rockville, MD, USA). OxiSelect
Ubiquitin Ligase COP1 Suppresses Neuroinflammation by Degrading c/EBPβ in Microglia
Ndoja, Reja, Lee et al
Cell (2020) 182 (5), 1156-1169.e12 DOI: 10.1016/j.cell.2020.07.011
Cited by 164
AI Summary: OriGene’s pCMV6-entry-c/EBPβ-Myc-DDK plasmid (Cat#MR227563) was used in this study to express c/EBPβ and investigate its regulation and role in microglial inflammation and neurodegeneration.
Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pRK5-Det1-HA This paper DNA908417 Plasmid: pCMV6-entry-c/EBPß-Myc-DDK Origene Cat#MR227563
Showing 1-6 of 11 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products