Foxo3 (NM_019740) Mouse Tagged ORF Clone
$923.00
In Stock*
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
|---|---|
| Target Symbol | Foxo3 |
| Synonyms | 1110048B16Rik; 2010203A17Rik; C76856; Fkhr2; FKHRL1; Foxo3a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_019740 |
| ORF Size | 2016 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_019740.3 |
| RefSeq Size | 2889 bp |
| RefSeq ORF | 2019 bp |
| Locus ID | 56484 |
| UniProt ID | Q9WVH4 |
| Cytogenetics | 10 22.79 cM |
| MW | 71.5 kDa |
| Summary | Transcriptional activator that recognizes and binds to the DNA sequence 5'-AGTAAATCA-3' and regulates different processes, such as apoptosis and autophagy (PubMed:18054316, PubMed:18054315, PubMed:23805378). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (PubMed:18054316, PubMed:18054315, PubMed:25402684). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (By similarity). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3' UTR of MYC transcript and prevent its translation (By similarity). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301).UniProtKB/Swiss-Prot Function |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_019740" in other vectors (4)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| MC220343 | Foxo3 (untagged) - Mouse forkhead box O3 (Foxo3), (10ug) | 10 ug |
$986.00
|
|
| MG226631 | Foxo3 (tGFP-tagged) - Mouse forkhead box O3 (Foxo3), (10ug) | 10 ug |
$1,123.00
|
|
| MR226631L3 | Lenti ORF clone of Foxo3 (Myc-DDK-tagged) - Mouse forkhead box O3 (Foxo3) | 10 ug |
$1,223.00
|
|
| MR226631L4 | Lenti ORF clone of Foxo3 (mGFP-tagged) - Mouse forkhead box O3 (Foxo3) | 10 ug |
$1,223.00
|
|
Citations
The APP intracellular domain promotes LRRK2 expression to enable feed-forward neurodegenerative mechanisms in Parkinson's disease
Zhang, Tu, Jiang et al
Sci Signal (2022) 15 (748), eabk3411 DOI: 10.1126/scisignal.abk3411
Zhang, Tu, Jiang et al
Sci Signal (2022) 15 (748), eabk3411 DOI: 10.1126/scisignal.abk3411
Cited by 13
AI Summary: In this study, the OriGene pCMV6-mmFOXO3a vector (MR226631) was used to express the mouse FOXO3a transcription factor, enabling the authors to investigate its role in the regulation of LRRK2 expression and neurodegenerative mechanisms in Parkinson’s disease.
Snippet: …The pCMV6-mmFOXO3a vector was purchased from OriGene (MR226631). For the PURO-GREEN-shRNA-FOXO3a-S1, the primer pair GATCCGGCCGAGAACCTCATGGACGACCTTCCTGTCAGAGTCGTCCATGAGGTTCTCGGCCTTTTTG and AATTCAAAAAGGCCGAGAACCTCATGGACGACTCTGACAGGAAGGTCGTCCATGAGGTTCTCGGCCG was annealed to form the shRNA loop structure targeting the mouse FOXO3a (target site underlined), which was inserted into the Bam HI and Eco RI sites of the PURO-GREEN vector. For the PURO-GREEN-shRNA-mmFOXO3a-S2, the primer pair
Amyloid precursor protein intracellular domain-dependent regulation of FOXO3a inhibits adult hippocampal neurogenesis
Jiang, Vanan, Tu et al
Neurobiol Aging (2020) 95, 250-263 DOI: 10.1016/j.neurobiolaging.2020.07.031
Jiang, Vanan, Tu et al
Neurobiol Aging (2020) 95, 250-263 DOI: 10.1016/j.neurobiolaging.2020.07.031
Cited by 24
Increased FoxO3a expression prevents osteoblast differentiation and matrix calcification
Tang, Pan, Doschak et al
Bone Rep (2019) 10, 100206 DOI: 10.1016/j.bonr.2019.100206
Tang, Pan, Doschak et al
Bone Rep (2019) 10, 100206 DOI: 10.1016/j.bonr.2019.100206
Cited by 11
AI Summary: In this study, OriGene’s FoxO3a expression vector (Cat# MR206218) and FoxO3a shRNA plasmid (Cat# TL315627) were used to modulate FoxO3a levels in osteoblasts, enabling the authors to investigate how changes in FoxO3a expression affect osteoblast differentiation and matrix calcification.
MicroRNA-223-3p regulates cell chemo-sensitivity by targeting FOXO3 in prostatic cancer
Feng, He, Wang
Gene (2018)
Feng, He, Wang
Gene (2018)
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
