Sox4 (NM_009238) Mouse Tagged ORF Clone
$686.00
In Stock*
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
|---|---|
| Target Symbol | Sox4 |
| Synonyms | AA682046; Sox-4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Restriction Sites |
SgfI-RsrII Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_009238 |
| ORF Size | 1320 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_009238.3 |
| RefSeq Size | 2969 bp |
| RefSeq ORF | 1323 bp |
| Locus ID | 20677 |
| UniProt ID | Q06831 |
| Cytogenetics | 13 12.87 cM |
| MW | 45.5 kDa |
| Summary | Transcriptional activator that binds with high affinity to the T-cell enhancer motif 5'-AACAAAG-3' motif.UniProtKB/Swiss-Prot Function |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_009238" in other vectors (3)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| MC215803 | Sox4 (untagged) - Mouse SRY-box containing gene 4 (Sox4), (10ug) | 10 ug |
$732.00
|
|
| MR207005L3 | Lenti ORF clone of Sox4 (Myc-DDK-tagged) - Mouse SRY-box containing gene 4 (Sox4) | 10 ug |
$986.00
|
|
| MR207005L4 | Lenti ORF clone of Sox4 (mGFP-tagged) - Mouse SRY-box containing gene 4 (Sox4) | 10 ug |
$986.00
|
|
Citations
Members of the AP-1 Family of Transcription Factors Regulate the Expression of Gja1 in Mouse GC-1 Spermatogonial Cells
Najih, Basque, Nguyen et al
Applied Sciences (2022) 12 (3), 1408 DOI: 10.3390/app12031408
Najih, Basque, Nguyen et al
Applied Sciences (2022) 12 (3), 1408 DOI: 10.3390/app12031408
Cited by 4
Integrin αvβ6-TGFβ-SOX4 Pathway Drives Immune Evasion in Triple-Negative Breast Cancer
Bagati, Kumar, Jiang et al
Cancer Cell (2020) 39 (1), 54-67.e9 DOI: 10.1016/j.ccell.2020.12.001
Bagati, Kumar, Jiang et al
Cancer Cell (2020) 39 (1), 54-67.e9 DOI: 10.1016/j.ccell.2020.12.001
Cited by 218
AI Summary: OriGene contributed to this study by providing the murine Sox4 cDNA with Myc-DDK tags in a pCMV6 vector (Cat #MR207005), which was used to investigate the role of SOX4 in immune evasion mechanisms in triple-negative breast cancer.
Snippet: Skip to article;The 1320 bp murine Sox4 cDNA equipped with a Myc-DDK tags in a pCMV6 vector was purchased from Origene (Cat #MR207005). Following PCR amplification using FWD primer 5′- CATACTAGTATGGTACAACAGACCA-3′ containing a 5′ SpeI restriction enzyme (RE) site and REV primer AAAAAACTCGAGTCAGTAGGTGAAGACCAGGTT containing a 3′ PspXI RE site, the Sox4 cDNA was cloned into the pINDUCER21-ORF-EG
The transcription factors SF-1 and SOX8 cooperate to upregulate Cx43 expression in mouse TM4 sertoli cells
Couture, Martin
Biochem Biophys Rep (2020) 24, 100828 DOI: 10.1016/j.bbrep.2020.100828
Couture, Martin
Biochem Biophys Rep (2020) 24, 100828 DOI: 10.1016/j.bbrep.2020.100828
Cited by 12
AI Summary: In this study, the mouse SOX4 expression vector from OriGene (Cat #: MR207005) was used to investigate the role of SOX transcription factors in regulating Cx43 expression in mouse TM4 Sertoli cells.
Snippet: … The mouse SOX4 expression vector was purchased from OriGene (Cat #: MR207005, OriGene Technologies, Inc., Rockville, MD). The SOX8 deletion construct (DN-SOX8), lacking amino acids 176–464 (Δ176–464), has been described previously [22]. 2.2 Cell;- The mouse SOX4 expression vector was purchased from OriGene (Cat #: MR207005, OriGene Technologies, Inc., Rockville, MD). The SOX8 deletion construct (DN-SOX8), lacking amino acids 176-464 (Δ176-464), has been described previously [22]. 2.2
Gja1 expression is regulated by cooperation between SOX8/SOX9 and cJUN transcription factors in TM4 and 15P-1 Sertoli cell lines
Ghouili, Roumaud, Martin
Mol. Reprod. Dev. (2018)
Ghouili, Roumaud, Martin
Mol. Reprod. Dev. (2018)
Transcription factors SF1 and cJUN cooperate to activate the Fdx1 promoter in MA-10 Leydig cells
Roumaud, Rwigemera, Martin
J Steroid Biochem Mol Biol (2017) 171, 121-132 DOI: 10.1016/j.jsbmb.2017.03.003
Roumaud, Rwigemera, Martin
J Steroid Biochem Mol Biol (2017) 171, 121-132 DOI: 10.1016/j.jsbmb.2017.03.003
Cited by 22
AI Summary: In this study, OriGene's cJUN (NM_010591) and SF1 (NM_010383) expression plasmids were used to investigate how these transcription factors cooperate to activate the Fdx1 promoter in MA-10 Leydig cells.
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
