Cryaa (NM_001278570) Mouse Untagged Clone

SKU
MC226065
Cryaa (untagged) - Mouse crystallin, alpha A (Cryaa), transcript variant 3
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cryaa
Synonyms Acry; Acry-1; Cry; Crya; Crya-1; Crya1; DAcry; DAcry-1; lop18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226065 representing NM_001278570
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTCACCATTCAGCATCCTTGGTTCAAGCGTGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTCG
ACCAGTTCTTCGGCGAGGGCCTTTTTGAGTACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCCTA
CTACCGCCAGTCCCTCTTCCGCACTGTGCTGGACTCGGGCATCTCTGAGGTCCGATCTGACCGGGACAAG
TTTGTCATCTTCTTGGACGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAGGATTTTG
TGGAGATTCACGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCACCGTCG
CTACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCCTGTCTGCGGATGGCATGCTGACC
TTCTCTGGCCCCAAGGTCCAGTCCGGTTTGGATGCTGGCCACAGCGAGAGGGCCATTCCTGTGTCACGGG
AGGAGAAACCCAGCTCTGCACCCTCGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001278570
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001278570.1, NP_001265499.1
RefSeq Size 1127 bp
RefSeq ORF 522 bp
Locus ID 12954
Cytogenetics 17 17.09 cM
Summary This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2014
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter compared to isoform 1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001278570" in other vectors (1)
SKU Description Size Price
MR228276 Cryaa (myc-DDK-tagged) - Mouse crystallin, alpha A (Cryaa), transcript variant 3 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.