OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ppp4r2 (BC056340) Mouse Untagged Clone

Be the first to review this product
SKU
MC218020
Ppp4r2 (untagged) - Mouse protein phosphatase 4, regulatory subunit 2 (cDNA clone MGC:73463 IMAGE:5703151), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ppp4r2 or BC056340"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ppp4r2
Synonyms BE691708; C230060M08Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC056340
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTCGAGAGGCTGCAGGAGGCGCTGAAAGATTTTGAGAAGAGAGGGAAAAAGGAAGTTTGTCCTG
TACTGGATCAGTTTCTCTGTCATGTAGCTAAAACTGGAGAAACAATGATTCAGTGGTCCCAATTTAAAGG
CTATTTCATTTTCAAACTGGAGAAAGTGATGGATGATTTCAGAACTTCAGCTCCTGAACCAAGAGGTCCT
CCCAATCCTAATGTTGAATATATTCCCTTTGATGAAATGAAGGAAAGAATACTGAAAATTGTCACTGGAT
TTAATGGTATCCCTTTTACTATTCAGCGGCTATGTGAATTGCTAACGGATCCGAGAAGAAACTATACAGG
AACAGACAAGTTTCTCAGAGGAGTAGAGAAGAATGTGATGGTTGTTAGCTGCGTTTGTCCATCCTCAGAG
AAGAACAATTCTAATAGCTTAAATAGAATGAATGGTGTTATGTTTCCTGGAAACTCACCAAACTATACTG
ACAGGTCTAATATAAACGGGCCTGGAACACCTAGGCCACTTAATCGACCAAAGCTTTCTTTGTCAGCCCC
CTTGACAACAAATGGTTTGCCTGAGAGCACAGATAGCAAAGATTCTGAGCTGCAGCTAAGTGAAGAGAAA
GGCCACAGTGATTCTTCAGCCTCTGAATCAGAAGTTTCCTTACTGAGCCCTGTTAAAAATAAACATCCAG
ATGAAGATGCTGTGGAGTCTGAGGAACATGAGGTGAAAAGACTGAAGTTTGACAAAGAAGGTGACGTCAG
AGAGACAGCTAGCCAAACGGTGTCTGGTGAAGTCTCTTCAGTTAGAGCAGAGGAAACGGAAACAGCAGCT
CCCCCTCCTGACAAGGACAGAGAAAGTCGAACCAGGCAGCACTGTACAGAAGAGGAGGAGGAGGAGGAGG
AAGAAGAGGAAGAGGAGGAGGAAGAATCGTTTATGACACCAAGAGAAATGGTCCCAGAAAGAAAAAATCA
AGAAAAGGAATCTGATGACGCCTTAACTGTGAATGAAGAGACTTCAGAGGAGAGCCATCAGATGGAAGGC
TCTGGTGTGTCTCCAGCTCAGACAGACTCCACTTCAGAAAGGAGTGACAGTGCAGGGGCCTCAAGGAGTG
GCTCTGACTGCCTGGAGACACAGGAGTCAGGAGGGCCCCCTTCCAGTAAGACTGGAGAGAGTGTGTCAGT
GCCGTCGTCCATGGAGAGTGAGGAAGCCGCAGAAGTCACAGATGACCCAATGGAGCAAGACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC056340
Insert Size 1254 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC056340, AAH56340
RefSeq Size 2769 bp
RefSeq ORF 1253 bp
Locus ID 232314
Cytogenetics 6 D3
Summary Regulatory subunit of serine/threonine-protein phosphatase 4 (PP4). May regulate the activity of PPP4C at centrosomal microtubule organizing centers. Its interaction with the SMN complex leads to enhance the temporal localization of snRNPs, suggesting a role of PPP4C in maturation of spliceosomal snRNPs. The PPP4C-PPP4R2-PPP4R3A PP4 complex specifically dephosphorylates H2AFX phosphorylated on 'Ser-140' (gamma-H2AFX) generated during DNA replication and required for DNA double strand break repair (By similarity). Mediates RPA2 dephosphorylation by recruiting PPP4C to RPA2 in a DNA damage-dependent manner. RPA2 dephosphorylation is required for the efficient RPA2-mediated recruitment of RAD51 to chromatin following double strand breaks, an essential step for DNA repair (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC056340" in other vectors (4)
SKU Description Size Price
MG206596 Ppp4r2 (tGFP-tagged) - Mouse protein phosphatase 4, regulatory subunit 2 (cDNA clone MGC:73463 IMAGE:5703151) 10 ug
$657.00
MR206596 Ppp4r2 (Myc-DDK-tagged) - Mouse protein phosphatase 4, regulatory subunit 2 (cDNA clone MGC:73463 IMAGE:5703151) 10 ug
$289.00 $457.00
MR206596L3 Lenti ORF clone of Ppp4r2 (Myc-DDK-tagged) - Mouse protein phosphatase 4, regulatory subunit 2 (cDNA clone MGC:73463 IMAGE:5703151) 10 ug
$757.00
MR206596L4 Lenti ORF clone of Ppp4r2 (mGFP-tagged) - Mouse protein phosphatase 4, regulatory subunit 2 (cDNA clone MGC:73463 IMAGE:5703151) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products