OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rps4x (BC106152) Mouse Untagged Clone

Be the first to review this product
SKU
MC217742
Rps4x (untagged) - Mouse ribosomal protein S4, X-linked (cDNA clone MGC:118104 IMAGE:3669367), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rps4x or BC106152"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rps4x
Synonyms Rps4; Rps4-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC106152
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCGTGGTCCCAAGAAACACCTGAAGCGTGTAGCTGCTCCAAAACATTGGATGCTGGATAAGTTGA
CTGGCGTGTTTGCTCCTCGTCCATCCACTGGTCCTCACAAGCTGAGGGAATGCCTGCCTCTCATCATTTT
CCTAAGGAACAGACTTAAGTATGCCCTGACTGGAGATGAAGTAAAAAAGATTTGCATGCAGCGATTCATT
AAGATTGATGGGAAAGTCAGGACCGATATAACCTACCCTGCTGGGTTTATGGATGTCATCAGCATTGACA
AGACCGGAGAGAACTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCATCGTATTACACCGGA
GGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTAGGCACAAAAGGAATCCCGCACCTGGTG
ACCCATGATGCTCGTACTATTCGGTACCCTGATCCCCTCATCAAGGTGAACGACACCATTCAGATTGATT
TGGAGACAGGCAAAATAACTGACTTCATCAAGTTTGACACTGGGAACCTGTGTATGGTGACTGGAGGTGC
TAACTTGGGAAGAATTGGTGTAATCACCAACAGAGAGAGACATCCCGGCTCTTTTGATGTGGTTCATGTG
AAAGATGCCAATGGCAACAGCTTTGCCACTCGGCTGTCCAACATTTTTGTTATTGGCAAGGGTAACAAAC
CATGGATCTCTCTTCCCAGAGGAAAAGGAATCCGCCTCACCATTGCTGAAGAGAGAGACAAGAGGCTTGC
GGCCAAACAGAGCAGTGGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC106152
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC106152, AAI06153
RefSeq Size 917 bp
RefSeq ORF 791 bp
Locus ID 20102
Cytogenetics X 45.2 cM
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC106152" in other vectors (4)
SKU Description Size Price
MG203477 Rps4x (tGFP-tagged) - Mouse ribosomal protein S4, X-linked (cDNA clone MGC:118104 IMAGE:3669367) 10 ug
$500.00
MR203477 Rps4x (Myc-DDK-tagged) - Mouse ribosomal protein S4, X-linked (cDNA clone MGC:118104 IMAGE:3669367) 10 ug
$289.00 $300.00
MR203477L3 Lenti ORF clone of Rps4x (Myc-DDK-tagged) - Mouse ribosomal protein S4, X-linked (cDNA clone MGC:118104 IMAGE:3669367) 10 ug
$600.00
MR203477L4 Lenti ORF clone of Rps4x (mGFP-tagged) - Mouse ribosomal protein S4, X-linked (cDNA clone MGC:118104 IMAGE:3669367) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products