OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mapkap1 (NM_177345) Mouse Untagged Clone

Be the first to review this product
SKU
MC217515
Mapkap1 (untagged) - Mouse mitogen-activated protein kinase associated protein 1 (Mapkap1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $536.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA363675 MAPKAP1 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mapkap1 or NM_177345"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mapkap1
Synonyms AI591529; D230039K05Rik; Sin1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC217515 representing NM_177345
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTTCTTGGACAATCCAACTATCATTCTAGCTCATATTCGACAGTCACACGTGACCAGTGATGACA
CAGGAATGTGTGAGATGGTTCTCATTGATCATGACGTTGACCTAGAGAAGACTCATCCTCCGTCAGTGCC
TGGAGACAGTGGGTCAGAAGTTCAGGGAAGCAGTGGTGAGACGCAGGGCTACATATACGCCCAGTCTGTT
GATATTACATCGAGCTGGGACTTTGGTATTAGAAGACGCTCAAACACAGCTCAAAGATTAGAACGACTCC
GCAAAGAGAGACAAAACCAGATCAAATGCAAAAATATTCAGTGGAAAGAAAGAAATTCTAAACAATCAGC
CCAGGAGTTAAAGTCACTGTTTGAAAAAAAATCCCTCAAAGAGAAGCCTCCAAGTTCAGGCAAGCAGTCC
ATATTGTCTGTACGCCTGGAGCAGTGCCCTCTGCAGCTGAATAACCCCTTTAATGAGTACTCCAAGTTTG
ATGGCAAGGGTCATGTGGGTACAACTGCAACTAAGAAGATCGACGTCTACCTCCCCCTGCACTCCAGCCA
GGACAGACTGCTGCCAATGACCGTGGTGACCATGGCCAGCGCCAGGGTGCAGGACCTCATCGGGCTCATC
TGTTGGCAGTACACGAGTGAAGGACGGGAGCCGAAGCTCAATGACAATGTCAGTGCCTACTGCCTGCATA
TTGCTGAGGATGATGGGGAGGTCGACACGGATTTTCCGCCACTGGATTCCAATGAGCCCATTCATAAGTT
TGGCTTCAGTACTTTGGCCCTGGTTGAAAAATACTCCTCTCCTGGTCTGACCTCCAAAGAGTCGCTCTTT
GTTCGAATAAATGCTGCTCATGGATTCTCCCTTATCCAAGTAGACAACACAAAGGTCACCATGAAGGAGA
TCTTGCTCAAGGCAGTGAAAAGAAGAAAAGGATCCCAGAAAATTTCAGGCCCTCAGTACCGCCTGGAGAA
GCAGAGTGAGCCTAACATCGCTGTGGACCTGGAGAGCACGCTGGAGAGCCAGAACGCCTGGGAGTTCTGC
CTGGTTCGCGAGAACAGTTCAAGGGCAGACGGAGTTTTCGAGGAGGATTCACAAATTGACATCGCTACAG
TACAGGATATGCTTAGCAGCCACCATTACAAGTCATTCAAAGTCAGCATGATCCACAGACTGCGATTCAC
GACGGATGTGCAGTTAGGTATCTCTGGAGACAAAGTAGAGATAGACCCTGTTACGAATCAGAAAGCCAGC
ACTAAGTTTTGGATTAAGCAGAAACCCATCTCAATCGATTGTGACCTGCTCTGTGCCTGTGACCTTGCCG
AGGAGAAGAGCCCCAGTCACGCGGTGTTTAAGCTCACGTATCTAAGCAGCCATGACTACAAGCACCTGTA
CTTCGAGTCCGACGCAGCCACAGTCAGTGAGATCGTGCTCAAGGTTAACTACATCCTGGAATCACGAGCG
AGCACTGCCCGAGCTGATTATCTTGCTCAAAAACAAAGAAAACTGAACAGGCGAACAAGCTTCAGCTTCC
AGAAGGAGAAGAAATCAGGGCAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_177345
Insert Size 1569 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_177345.4, NP_796319.1
RefSeq Size 3452 bp
RefSeq ORF 1569 bp
Locus ID 227743
UniProt ID Q8BKH7
Cytogenetics 2 B
Summary Subunit of mTORC2, which regulates cell growth and survival in response to hormonal signals. mTORC2 is activated by growth factors, but, in contrast to mTORC1, seems to be nutrient-insensitive. mTORC2 seems to function upstream of Rho GTPases to regulate the actin cytoskeleton, probably by activating one or more Rho-type guanine nucleotide exchange factors. mTORC2 promotes the serum-induced formation of stress-fibers or F-actin. mTORC2 plays a critical role in AKT1 'Ser-473' phosphorylation, which may facilitate the phosphorylation of the activation loop of AKT1 on 'Thr-308' by PDK1 which is a prerequisite for full activation. mTORC2 regulates the phosphorylation of SGK1 at 'Ser-422'. mTORC2 also modulates the phosphorylation of PRKCA on 'Ser-657'. Within mTORC2, MAPKAP1 is required for complex formation and mTORC2 kinase activity. MAPKAP1 inhibits MAP3K2 by preventing its dimerization and autophosphorylation. Inhibits HRAS and KRAS signaling. Enhances osmotic stress-induced phosphorylation of ATF2 and ATF2-mediated transcription. Isoform 1 is involved in ciliogenesis, regulates cilia length through its interaction with CCDC28B independently of mTORC2 complex.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 2, and 4 all encode the same isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_177345" in other vectors (4)
SKU Description Size Price
MG208361 Mapkap1 (tGFP-tagged) - Mouse mitogen-activated protein kinase associated protein 1 (Mapkap1) 10 ug
$489.00 $686.00
MR208361 Mapkap1 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase associated protein 1 (Mapkap1) 10 ug
$289.00 $486.00
MR208361L3 Lenti ORF clone of Mapkap1 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase associated protein 1 (Mapkap1) 10 ug
$786.00
MR208361L4 Lenti ORF clone of Mapkap1 (mGFP-tagged) - Mouse mitogen-activated protein kinase associated protein 1 (Mapkap1) 10 ug
$786.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products