OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Pak2 (NM_177326) Mouse Untagged Clone

Be the first to review this product
SKU
MC217513
Pak2 (untagged) - Mouse p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $538.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Pak2 or NM_177326"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pak2
Synonyms 5330420P17Rik; A130002K10Rik; AI836325; D16Ertd269e; mKIAA4182; PAK-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC217513 representing NM_177326
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGATAACGGAGAGCTAGAAGACAAGCCCCCAGCACCTCCAGTTCGGATGAGCAGTACCATTTTTA
GCACCGGAGGAAAAGATCCTTTATCAGCCAATCACAGTTTGAAACCTTTGCCTTCTGTTCCAGAGGAAAA
AAAACCCAGGAACAAAATCATCTCCATATTCTCTGGCACAGAAAAAGGAAGTAAAAAGAAAGAAAAAGAA
CGGCCAGAGATTTCTCCCCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACGGGAG
AGTTCACTGGCATGCCAGAACAGTGGGCGCGGCTGTTGCAGACCTCCAACATTACCAAACTCGAGCAGAA
GAAGAACCCTCAGGCAGTGCTGGATGTCTTGAAGTTCTACGACTCCAACACTGTGAAACAGAAGTACCTG
AGTTTCACTCCTCCTGAGAAAGATGGCTTCCCTTCTGGAACACCAGCACTGAACACCAAGGGGTCAGAGA
CATCAGCTGTAGTGACAGAGGAAGATGATGATGATGAAGACGCTGCTCCTCCCGTCATTGCCCCTCGGCC
AGATCATACAAAATCAATTTACACACGGTCTGTCATCGACCCCATTCCTGCTCCAGTTGGTGATTCTAAT
GTTGACAGTGGTGCCAAGTCTTCAGACAAACAGAAAAAGAAAGCCAAGATGACCGATGAAGAGATTATGG
AGAAATTAAGAACTATTGTGAGCATAGGGGACCCAAAGAAAAAATACACAAGATATGAAAAAATTGGGCA
AGGGGCTTCTGGAACAGTTTTTACTGCCACTGATGTGGCCCTGGGGCAAGAGGTTGCTATCAAGCAGATT
AATTTACAGAAACAACCAAAGAAGGAATTGATCATTAATGAAATTCTGGTGATGAAAGAGTTAAAGAATC
CCAACATAGTTAACTTCTTGGACAGTTACCTGGTAGGAGATGAGTTGTTTGTGGTAATGGAGTACCTCGC
TGGTGGGTCCCTCACTGATGTTGTAACAGAAACCTGCATGGACGAAGCGCAGATTGCCGCCGTGTGCAGA
GAGTGTTTACAGGCGTTGGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATG
TGCTTTTGGGAATGGAAGGCTCAGTTAAACTTACTGACTTCGGCTTCTGTGCCCAGATCACTCCTGAACA
GAGCAAACGCAGTACTATGGTTGGAACACCGTACTGGATGGCACCAGAGGTGGTGACACGGAAAGCCTAT
GGTCCCAAAGTTGACATATGGTCTCTGGGCATCATGGCTATCGAGATGGTTGAAGGAGAGCCTCCATACC
TCAACGAAAATCCTCTGCGGGCATTATACCTGATAGCTACAAATGGAACTCCTGAACTTCAGAATCCAGA
AAAACTTTCCCCAATATTTCGGGATTTCTTAAATCGGTGTTTGGAAATGGATGTGGAGAAAAGGGGTTCG
GCCAAGGAACTGTTACAGCATCCTTTCCTGAAACTGGCCAAACCATTGTCTAGCTTGACGCCACTGATCC
TGGCAGCTAAAGAAGCAATGAAGAGTAACCGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_177326
Insert Size 1575 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_177326.3, NP_796300.1
RefSeq Size 5741 bp
RefSeq ORF 1575 bp
Locus ID 224105
UniProt ID Q8CIN4
Cytogenetics 16 22.4 cM
Summary Serine/threonine protein kinase that plays a role in a variety of different signaling pathways including cytoskeleton regulation, cell motility, cell cycle progression, apoptosis or proliferation. Acts as downstream effector of the small GTPases CDC42 and RAC1. Activation by the binding of active CDC42 and RAC1 results in a conformational change and a subsequent autophosphorylation on several serine and/or threonine residues. Full-length PAK2 stimulates cell survival and cell growth. Phosphorylates MAPK4 and MAPK6 and activates the downstream target MAPKAPK5, a regulator of F-actin polymerization and cell migration. Phosphorylates JUN and plays an important role in EGF-induced cell proliferation. Phosphorylates many other substrates including histone H4 to promote assembly of H3.3 and H4 into nucleosomes, BAD, ribosomal protein S6, or MBP. Additionally, associates with ARHGEF7 and GIT1 to perform kinase-independent functions such as spindle orientation control during mitosis. On the other hand, apoptotic stimuli such as DNA damage lead to caspase-mediated cleavage of PAK2, generating PAK-2p34, an active p34 fragment that translocates to the nucleus and promotes cellular apoptosis involving the JNK signaling pathway. Caspase-activated PAK2 phosphorylates MKNK1 and reduces cellular translation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_177326" in other vectors (3)
SKU Description Size Price
MR208417 Pak2 (Myc-DDK-tagged) - Mouse p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2) 10 ug
$289.00 $488.00
MR208417L3 Lenti ORF clone of Pak2 (Myc-DDK-tagged) - Mouse p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2) 10 ug
$788.00
MR208417L4 Lenti ORF clone of Pak2 (mGFP-tagged) - Mouse p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2) 10 ug
$788.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products