OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Kat7 (NM_177619) Mouse Untagged Clone

Be the first to review this product
SKU
MC217512
Kat7 (untagged) - Mouse MYST histone acetyltransferase 2 (Myst2), transcript variant 3, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $487.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA312332 Rabbit polyclonal anti-MYST2 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Kat7 or NM_177619"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Kat7
Synonyms Hbo1; Hboa; Myst2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_177619, the custom clone sequence may differ by one or more nucleotides


ATGCCGCGAAGGAAGAGAAATGCAGGCAGTAGTTCAGATGGAACCGAAGATTCCGATTTTTCTACAGATC
TCGAGCATACAGACAGTTCAGAGAGTGATGGCACCTCGCGCCGATCTGCCCGAGTCACCCGCTCCTCAGC
CAGGCTAAGCCAGAGTTCCCAAGAAACTAAAAATACAGCTGATCATGATGAGTCACCACCTCGAACTCCA
ACCGGAAATGCACCTTCTTCTGAGTCTGACATAGACATCTCCAGCCCCAACGTGTCTCATGATGAGAGCA
TTGCCAAGGACATGTCCCTGAAGGACTCAGGCAGTGATCTCTCTCACCGTCCCAAGCGACGTCGATTTCA
CGAAAGCTACAATTTCAACATGAAGTGTCCTACGCCGGGCTGCAACTCTCTAGGACATCTTACAGGAAAG
CACGAGAGACATTTCTCCATCTCAGGATGCCCGCTGTATCATAACCTCTCAGCTGACGAATGCAAGGCAC
CAACAGAGAGACAGCTGCGGTATAAGGAAAAGGTGGCTGAACTCAGGAAGAAAAGAAATTCTGGACTGAG
CAAAGAGCAGAAGGAGAAATACATGGAACACAGACAGACCTATGGGAACACTCGGGAGCCTCTCTTGGAA
AACCTGACAAGTGAATATGACTTAGATCTTTTCCGAAGAGCACAAGCCCGGGCTTCTGAGGATTTGGAGA
AGTTAAGGCTTCAAGGCCAAATCACAGAGGGAAGCAACATGATTAAAACAATTGCTTTTGGCCGCTATGA
ACTGGACACTTGGTACCACTCTCCCTATCCTGAGGAATATGCGAGGCTGGGACGTCTCTACATGTGTGAA
TTCTGCTTAAAGTACATGAAGAGCCAGACAATCCTCCGCCGACACATGGCCAAGTGTGTGTGGAAACACC
CCCCTGGTGATGAGATTTATCGCAAAGGCTCCATCTCTGTGTTTGAAGTAGACGGCAAGAAGAACAAGAT
CTACTGCCAAAACCTCTGCCTTTTGGCAAAGCTTTTTCTGGACCATAAGACGCTATACTATGATGTAGAA
CCTTTCCTGTTCTACGTTATGACAGAAGCGGACAATACTGGCTGTCATCTGATTGGATATTTTTCTAAGG
AGAAGAATTCATTTCTCAACTATAATGTCTCGTGCATCCTCACCATGCCTCAGTACATGCGACAGGGCTA
CGGGAAGATGCTGATCGATTTCAGTTATTTACTTTCCAAAGTAGAAGAGAAAGTCGGCTCTCCAGAGCGC
CCACTGTCAGACCTGGGGCTCATAAGCTACCGCAGCTACTGGAAGGAGGTACTGCTCCGATACCTGCACA
ACTTCCAGGGCAAGGAGATCTCCATCAAAGAAATTAGCCAGGAAACAGCTGTGAATCCCGTGGACATTGT
CAGCACTCTGCAAGCCCTTCAGATGCTCAAGTATTGGAAAGGCAAGCACCTAGTTTTAAAGAGACAGGAC
CTGATAGATGAGTGGATAGCCAAAGAGGCCAAAAGGTCCAACTCCAACAAAACCATGGATCCAAGCTGCT
TAAAATGGACCCCTCCCAAGGGCACTTAA
Restriction Sites SgfI-MluI |
ACCN NM_177619
Insert Size 1569 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC048904, AAH48904
RefSeq Size 3262 bp
RefSeq ORF 1569 bp
Locus ID 217127
UniProt ID Q5SVQ0
Cytogenetics 11 D
Summary Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Involved in H3K14 (histone H3 lysine 14) acetylation and cell proliferation (PubMed:23319590). Through chromatin acetylation it may regulate DNA replication and act as a coactivator of TP53-dependent transcription. Acts as a coactivator of the licensing factor CDT1. Specifically represses AR-mediated transcription.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_177619" in other vectors (4)
SKU Description Size Price
MG208357 Kat7 (tGFP-tagged) - Mouse MYST histone acetyltransferase 2 (Myst2) 10 ug
$687.00
MR208357 Kat7 (Myc-DDK-tagged) - Mouse MYST histone acetyltransferase 2 (Myst2), transcript variant 3 10 ug
$289.00 $487.00
MR208357L3 Lenti ORF clone of Kat7 (Myc-DDK-tagged) - Mouse MYST histone acetyltransferase 2 (Myst2), transcript variant 3 10 ug
$787.00
MR208357L4 Lenti ORF clone of Kat7 (mGFP-tagged) - Mouse MYST histone acetyltransferase 2 (Myst2), transcript variant 3 10 ug
$787.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products