OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ppp2r5c (NM_001081458) Mouse Untagged Clone

Be the first to review this product
SKU
MC215903
Ppp2r5c (untagged) - Mouse protein phosphatase 2, regulatory subunit B (B56), gamma isoform (Ppp2r5c), transcript variant 3, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ppp2r5c or NM_001081458"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ppp2r5c
Synonyms 2610043M05Rik; 2700063L20Rik; AI060890; AW545884; C85228; D12Bwg0916e; mKIAA0044
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC215903 representing NM_001081458
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGACATGTAATAAAGCGGGCAGCGGGATGGTGGTGGATGCGGCCAGCTCCAACGGGCCTTTCCAGC
CCGTGGCCCTTCTCCACATTCGAGATGTTCCTCCTGCGGATCAAGAGAAGCTTTTTATCCAGAAGCTACG
CCAGTGTTGTGTCCTCTTTGACTTTGTCTCTGACCCACTGAGTGACCTGAAGTGGAAGGAAGTAAAGCGC
GCTGCGCTGAGCGAGATGGTGGAGTATATCACCCACAACCGGAACGTGATCACGGAGCCCATTTACCCCG
AGGCCGTCCACATGTTTGCAGTTAACATGTTCCGAACCTTGCCACCTTCCTCCAATCCCACGGGAGCAGA
ATTCGACCCAGAAGAGGATGAACCAACGTTAGAAGCAGCCTGGCCTCATCTGCAGCTTGTTTATGAATTT
TTCTTAAGATTTTTAGAGTCTCCAGATTTCCAACCCAATATAGCAAAGAAATATATTGATCAGAAGTTTG
TATTGCAGCTTCTAGAGCTGTTTGACAGCGAGGATCCTCGGGAGAGAGATTTTCTAAAAACCACCCTGCA
CAGAATCTATGGGAAGTTCTTAGGCCTGCGTGCTTACATCAGGAAACAGATCAATAATATATTTTATAGG
TTTATCTATGAGACAGAGCATCACAATGGCATAGCGGAGTTACTGGAGATCCTGGGAAGTATAATTAATG
GATTTGCCTTACCACTGAAGGAGGAACACAAGATTTTCCTGCTGAAGGTGTTGCTGCCCTTGCACAAAGT
GAAGTCCCTGAGTGTCTACCATCCCCAGCTGGCGTACTGTGTCGTGCAGTTTTTAGAGAAGGACAGCACC
CTCACTGAACCAGTGGTAATGGCACTTCTCAAATACTGGCCAAAGACTCACAGTCCAAAAGAAGTAATGT
TCTTAAATGAATTAGAAGAAATTTTAGATGTAATTGAACCATCAGAGTTTGTGAAGATCATGGAGCCTCT
TTTCCGACAGTTAGCCAAATGTGTTTCCAGCCCTCACTTCCAGGTGGCCGAGCGGGCGCTCTATTACTGG
AACAACGAGTACATCATGAGTTTAATCAGTGACAACGCAGCGAAGATTCTGCCCATCATGTTTCCGTCCT
TATACCGCAACTCAAAGACCCACTGGAACAAGACAATACACGGCTTGATATACAACGCCCTGAAACTCTT
CATGGAGATGAACCAAAAACTCTTCGATGACTGCACTCAGCAGTTCAAAGCAGAGAAACTCAAAGAGAAG
CTAAAAATGAAAGAGCGAGAAGAAGCATGGGTTAAAATAGAAAATCTAGCCAAAGCGAATCCCCAGGTAC
TAAAAAAGAGAGTAACTCGGGAGTGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001081458
Insert Size 1359 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001081458.2, NP_001074927.1
RefSeq Size 2383 bp
RefSeq ORF 1359 bp
Locus ID 26931
UniProt ID Q60996
Cytogenetics 12 60.56 cM
Summary The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. The PP2A-PPP2R5C holoenzyme may activate TP53 and play a role in DNA damage-induced inhibition of cell proliferation. PP2A-PPP2R5C may also regulate the ERK signaling pathway through ERK dephosphorylation (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The resulting isoform (c) is shorter and has a distinct C-terminus, compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001081458" in other vectors (4)
SKU Description Size Price
MG207212 Ppp2r5c (tGFP-tagged) - Mouse protein phosphatase 2, regulatory subunit B (B56), gamma isoform (Ppp2r5c), transcript variant 3 10 ug
$657.00
MR207212 Ppp2r5c (Myc-DDK-tagged) - Mouse protein phosphatase 2, regulatory subunit B (B56), gamma isoform (Ppp2r5c), transcript variant 3 10 ug
$289.00 $457.00
MR207212L3 Lenti ORF clone of Ppp2r5c (Myc-DDK-tagged) - Mouse protein phosphatase 2, regulatory subunit B (B56), gamma isoform (Ppp2r5c), transcript variant 3 10 ug
$757.00
MR207212L4 Lenti ORF clone of Ppp2r5c (mGFP-tagged) - Mouse protein phosphatase 2, regulatory subunit B (B56), gamma isoform (Ppp2r5c), transcript variant 3 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products