H2bc9 (NM_178197) Mouse Untagged Clone

SKU
MC214389
Hist1h2bh (untagged) - Mouse histone cluster 1, H2bh (Hist1h2bh), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol H2bc9
Synonyms H2b-221; Hist1h2; Hist1h2bh
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214389 representing NM_178197
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGAGCCCGCCAAGTCCGCTCCTGCCCCGAAGAAGGGCTCCAAGAAGGCCCTGACCAAGGCCCAGA
AGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACGTGTACAAGGTGCTGAA
GCAAGTGCACCCCGACACCGGCATCTCCTCCAAAGCCATGGGCATCATGAACTCGTTCGTGAACGACATC
TTCGAGCGCATCGCGGGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACGTCCCGGG
AGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCCGTGTCGGAGGGCACCAA
GGCTGTCACCAAGTACACCAGCTCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_178197
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178197.2, NP_835504.1
RefSeq Size 522 bp
RefSeq ORF 381 bp
Locus ID 319182
UniProt ID Q64478
Cytogenetics 13 A3.1
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. provided by RefSeq, Aug 2015
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_178197" in other vectors (4)
SKU Description Size Price
MG218748 Hist1h2bh (tGFP-tagged) - Mouse histone cluster 1 H2bh (Hist1h2bh), (10ug) 10 ug
$350.00
MR218748 Hist1h2bh (Myc-DDK-tagged) - Mouse histone cluster 1, H2bh (Hist1h2bh) 10 ug
$289.00
MR218748L3 Lenti ORF clone of Hist1h2bh (Myc-DDK-tagged) - Mouse histone cluster 1, H2bh (Hist1h2bh) 10 ug
$450.00
MR218748L4 Lenti ORF clone of Hist1h2bh (mGFP-tagged) - Mouse histone cluster 1, H2bh (Hist1h2bh) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products