OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Olfr197 (NM_146484) Mouse Untagged Clone

Be the first to review this product
SKU
MC213653
Olfr197 (untagged) - Mouse olfactory receptor 197 (Olfr197), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Olfr197 or NM_146484"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Olfr197
Synonyms MOR183-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC213653 representing NM_146484
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAACAGAGAACACAACACTGCTGACAGAATTTGTTCTCACGGGACTCAGTCACCAGCCACAATGGA
AAATCCCCCTGTTCCTGCTGTTCTTGGTCATCTATCTTATCACCATTGTGGGGAACCTTGGTCTGATCAT
TCTCATCTGGAATGACCCTCGCCTTCAAATACCCATGTACCTATTTCTTGGGTGTTTAGCTCTTGTTGAT
ACTTTGTTATCATCCACAGTGACACCAAAGATGCTCCTCACCTTCACAGCTAAGAGCAAACTGATCTCTC
TTTCTGAATGCATGATACAGTTCTTTTCATTTGTGATGTGTGCAACTATGGAATGTTTTCTCTTGGCAGC
AATGGCCTACGATCGCTATGCAGCCATATGCAAACCCTTACTGTACCCAGTGATCATGACAAATAGACTG
TGTGTTCGTCTGTTAGTCTTGACCTTTGTAACTGGAATTCTTCATGCTTCAATTCATGAAGGCATGCTGT
GCCGATTAACCTTCTGTAATTCCAATGTAATACATCACTTTTACTGTGATGTTATGCCACTGTTAAAGAT
TTCCTGTACCGACCCTTCTCTTAATTACCTGATTGTTTTTATTTTCTCTGGCTCAATTCAAGTTTTCACT
ATCTCAACTATTCTAGGCTCTTACACACTTGTTCTCTTTACAATCTTAAAAAAGAAATCTGCCAAAGGCA
TAAAGAAAGCCTTCTCCACCTGTGGAGCTCATCTCCTTTCTGTGTGCTTATATTATGGTTCTCTTCTCTT
CATGTATCTGCTTCCTGCATCCCAAAAAGCACAGGATGAAGACATGATGGACTCTGTATTCTACACTGTC
ATAATCCCTGTGATGAATCCAATCATCTATAGTTTGAGAAACAAGCAAATCAAAGACTCACTGGAAAAAT
TCTTAAAGAGAAATGTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_146484
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_146484.1, NP_666695.1
RefSeq Size 930 bp
RefSeq ORF 930 bp
Locus ID 258477
Cytogenetics 16 C1.3
Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. This olfactory receptor gene appears to represent a strain-specific polymorphic pseudogene in mouse, where some strains, including the C57BL/6 reference genome strain, have a non-functional allele, while other strains have a protein-coding allele. provided by RefSeq, Jan 2019
Transcript Variant: This variant (1) represents the functional non-reference strain allele and encodes the full-length protein. Sequence Note: This RefSeq record was created from genomic sequence data from a non-reference strain to represent the functional allele. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## polymorphic pseudogene :: based on alignments, homology ##RefSeq-Attributes-END##
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_146484" in other vectors (4)
SKU Description Size Price
MG212901 Olfr197 (tGFP-tagged) - Mouse olfactory receptor 197 (Olfr197), (10ug) 10 ug
$500.00
MR212901 Olfr197 (Myc-DDK-tagged) - Mouse olfactory receptor 197 (Olfr197) 10 ug
$289.00 $300.00
MR212901L3 Lenti ORF clone of Olfr197 (Myc-DDK-tagged) - Mouse olfactory receptor 197 (Olfr197) 10 ug
$600.00
MR212901L4 Lenti ORF clone of Olfr197 (mGFP-tagged) - Mouse olfactory receptor 197 (Olfr197) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products