Mrap2 (NM_001101482) Mouse Untagged Clone

SKU
MC213207
Mrap2 (untagged) - Mouse melanocortin 2 receptor accessory protein 2 (Mrap2), transcript variant 2, (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mrap2
Synonyms BB633055
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC213207 representing NM_001101482
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGATGTCTGCCCAGAGGCTGGCTTCTAACAGGACATCCCCACAGTCACCATCGAACTCTGACTACA
CCTGGGAATACGAGTACTATGAGATCGGACCAGTTTCCTTTGAAGGACTGAAGGCTCATAAATATTCCAT
TGTGATTGGATTCTGGGTTGGTCTTGCGGTCTTTGTGATTTTCATGTTTTTTGTGCTGACTTTGCTGACG
AAGACAGGTGCCCCACACCAAGACAACGCGGAGTCCTCAGAGAGGAGGTTCCGCATGAACAGCTTTGTGT
CAGACTTCGGGAAGCCGCTGGAGTCAGACAAGGTGTTTTCTCGTCAGGGCAACGAGGAGTCCAGGTCTCT
GTTCCACTGTTACATCAATGAAGTAGAACACTTGGACAGGGTTAAAGTTTGCCACCAAACAACAGCCATC
GACAGTGATGTCCACCTCCAGGAAGCCAGCAGAAGCAGTGGGAGGCCTGAGGAGGAGCTAGCCAGGTTCA
TGAAGTTTGACATCCCCAACTTTGTGAACACAGAGCAGAGCTCCTTTGGGGAGGATGATCTCCTGATTTC
GGAAGCACCCGTTCTTCTAGAAAACAAGCCAGTTTCCCAGACATCACGCATAGACCTGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001101482
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001101482.2, NP_001094952.2
RefSeq Size 1948 bp
RefSeq ORF 624 bp
Locus ID 244958
UniProt ID D3Z1Q2
Cytogenetics 9 E3.1
Summary Modulator of melanocortin receptor 4 (MC4R), a receptor involved in energy homeostasis. Plays a central role in the control of energy homeostasis and body weight regulation by increasing ligand-sensitivity of MC4R and MC4R-mediated generation of cAMP. May also act as a negative regulator of MC2R: competes with MRAP for binding to MC2R and impairs the binding of corticotropin (ACTH) to MC2R. May also regulate activity of other melanocortin receptors (MC1R, MC3R and MC5R); however, additional evidence is required in vivo.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001101482" in other vectors (4)
SKU Description Size Price
MG224603 Mrap2 (tGFP-tagged) - Mouse melanocortin 2 receptor accessory protein 2 (Mrap2) transcript variant 2, (10ug) 10 ug
$500.00
MR224603 Mrap2 (Myc-DDK-tagged) - Mouse melanocortin 2 receptor accessory protein 2 (Mrap2), transcript variant 2 10 ug
$289.00 $300.00
MR224603L3 Lenti ORF clone of Mrap2 (Myc-DDK-tagged) - Mouse melanocortin 2 receptor accessory protein 2 (Mrap2), transcript variant 2 10 ug
$600.00
MR224603L4 Lenti ORF clone of Mrap2 (mGFP-tagged) - Mouse melanocortin 2 receptor accessory protein 2 (Mrap2), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products