OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mrgpra4 (NM_153524) Mouse Untagged Clone

Be the first to review this product
SKU
MC213013
Mrgpra4 (untagged) - Mouse MAS-related GPR, member A4 (Mrgpra4), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mrgpra4 or NM_153524"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mrgpra4
Synonyms Mgrg10; MrgA4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_153524, the custom clone sequence may differ by one or more nucleotides


ATGGCACCCACAACAACAAATCCAATGAACGAAACCATCCCTGGAAGTATTGACATCGAGACCCTGATCC
CAAACTTGATGATCATCATCTTCGGACTGGTCGGGCTGACAGGAAATGTCATTTTGTTTTGGCTCCTGGG
CTTCCACTTGCACAGGAATGCCTTCTTAGTCTACATCCTAAACTTGGCCCTGGCTGACTTCCTCTTCCTT
CTCTGTCACATCATAAATTCCACAATGCTTCTTCTCAAGGTTCACCTACCCAACAATATTTTGAACCATT
GCTTTGACATCATCATGACAGTTCTCTACATCACAGGCCTGAGCATGCTCAGTGCCATCAGCACTGAGCG
CTGCCTGTCTGTCCTGTGCCCCATCTGGTATCGGTGCCGCCGCCCAGAACACACATCAACTGTCCTGTGT
GCTGTGATCTGGTTCCTGCCCCTGTTGATCTGCATTCTGAATGGATATTTCTGTCATTTCTTTGGTCCCA
AATATGTAATTGACTCTGTGTGTCTGGCAACGAACTTCTTTATCAGAACATACCCGATGTTTTTGTTTAT
AGTCCTCTGTCTGTCCACCCTGGCTCTGCTGGCCAGGTTGTTCTGTGGTGCTGGGAAGACGAAATTTACC
AGATTATTCGTGACCATCATGCTGACCGTTTTGGTTTTTCTTCTCTGTGGGTTGCCCCTGGGCTTCTTCT
GGTTTCTGGTGCCCTGGATTAACCGTGATTTCAGTGTACTAGATTATATACTTTTTCAGACATCACTTGT
CCTAACTTCTGTTAACAGCTGTGCCAACCCCATCATTTACTTCTTTGTGGGCTCCTTCAGGCATCGGTTG
AAGCACAAGACCCTCAAAATGGTTCTCCAGAGTGCATTGCAGGACACTCCTGAGACACCTGAAAACATGG
TGGAGATGTCAAGAAGCAAAGCAGAGCCGTG::A
Restriction Sites SgfI-MluI |
ACCN NM_153524
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC115741, AAI15742
RefSeq Size 1259 bp
RefSeq ORF 942 bp
Locus ID 235854
UniProt ID Q91WW2
Cytogenetics 7 B4
Summary Orphan receptor. May be a receptor for RFamide-family neuropeptides such as NPFF and NPAF, which are analgesic in vivo. May regulate nociceptor function and/or development, including the sensation or modulation of pain.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153524" in other vectors (4)
SKU Description Size Price
MG216115 Mrgpra4 (tGFP-tagged) - Mouse MAS-related GPR member A4 (Mrgpra4), (10ug) 10 ug
$500.00
MR216115 Mrgpra4 (Myc-DDK-tagged) - Mouse MAS-related GPR, member A4 (Mrgpra4) 10 ug
$289.00 $300.00
MR216115L3 Lenti ORF clone of Mrgpra4 (Myc-DDK-tagged) - Mouse MAS-related GPR, member A4 (Mrgpra4) 10 ug
$600.00
MR216115L4 Lenti ORF clone of Mrgpra4 (mGFP-tagged) - Mouse MAS-related GPR, member A4 (Mrgpra4) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products