OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ffar1 (NM_194057) Mouse Untagged Clone

Be the first to review this product
SKU
MC212962
Ffar1 (untagged) - Mouse free fatty acid receptor 1 (Ffar1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ffar1 or NM_194057"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ffar1
Synonyms Gpr40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_194057.2
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCTGCCCCCACAGCTCTCCTTCGCTCTCTATGTATCTGCCTTTGCGCTGGGCTTTCCATTGAACT
TGTTAGCCATCCGAGGCGCAGTGTCCCACGCTAAACTGCGACTCACTCCCAGCTTGGTCTACACTCTCCA
TCTGGGCTGCTCTGATCTCCTACTGGCCATCACTCTGCCCCTGAAGGCTGTGGAGGCCCTGGCTTCTGGA
GCCTGGCCCCTGCCGCTCCCCTTCTGCCCAGTCTTTGCCTTGGCCCACTTTGCTCCCCTCTACGCAGGCG
GAGGCTTCCTAGCTGCTCTCAGCGCTGGCCGCTACCTGGGGGCTGCCTTCCCCTTCGGGTACCAAGCCAT
CCGGAGGCCCCGCTATTCCTGGGGTGTGTGTGTGGCTATATGGGCCCTTGTCCTCTGCCACCTGGGGCTG
GCCCTTGGCTTGGAGACTTCCGGAAGCTGGCTGGACAACAGTACCAGTTCCCTGGGCATCAACATACCCG
TGAATGGCTCCCCGGTCTGCCTGGAAGCCTGGGATCCCGACTCTGCCCGCCCTGCCCGTCTCAGTTTCTC
CATTCTGCTCTTCTTTCTGCCCTTGGTCATCACTGCCTTCTGCTATGTGGGCTGCCTCCGGGCCCTGGTG
CGCTCAGGCCTGAGCCACAAACGGAAGCTCAGGGCAGCTTGGGTGGCCGGAGGCGCTCTCCTCACACTCC
TGCTCTGCCTGGGGCCCTATAATGCCTCCAATGTGGCTAGTTTCATAAACCCGGACCTAGGAGGCTCCTG
GAGGAAGTTGGGACTCATCACAGGGGCCTGGAGTGTGGTACTCAACCCACTGGTCACTGGCTACTTGGGA
ACAGGTCCTGGACGGGGAACAATATGTGTGACGAGGACTCAAAGAGGAACAATTCAGAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_194057
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_194057.2, NP_918946.2
RefSeq Size 903 bp
RefSeq ORF 903 bp
Locus ID 233081
UniProt ID Q76JU9
Cytogenetics 7 B1
Summary G-protein coupled receptor for medium and long chain saturated and unsaturated fatty acids that plays an important role in glucose homeostasis. Fatty acid binding increases glucose-stimulated insulin secretion, and may also enhance the secretion of glucagon-like peptide 1 (GLP-1). May also play a role in bone homeostasis; receptor signaling activates pathways that inhibit osteoclast differentiation (PubMed:23335512). Ligand binding leads to a conformation change that triggers signaling via G-proteins that activate phospholipase C, leading to an increase of the intracellular calcium concentration. Seems to act through a G(q) and G(i)-mediated pathway.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_194057" in other vectors (4)
SKU Description Size Price
MG222997 Ffar1 (tGFP-tagged) - Mouse free fatty acid receptor 1 (Ffar1), (10ug) 10 ug
$489.00 $500.00
MR222997 Ffar1 (Myc-DDK-tagged) - Mouse free fatty acid receptor 1 (Ffar1) 10 ug
$289.00 $300.00
MR222997L3 Lenti ORF clone of Ffar1 (Myc-DDK-tagged) - Mouse free fatty acid receptor 1 (Ffar1) 10 ug
$600.00
MR222997L4 Lenti ORF clone of Ffar1 (mGFP-tagged) - Mouse free fatty acid receptor 1 (Ffar1) 10 ug
$600.00

file-alt Citations

Branched fatty acid esters of hydroxy fatty acids (FAHFAs) protect against colitis by regulating the gut innate and adaptive immune systems
Lee, Moraes-Vieira, Castoldi et al
J. Biol. Chem. (2016)
AI Summary: OriGene’s mGPR40 plasmid (#MC212962) was used to transfect cells and investigate the role of GPR40 in the anti-inflammatory effects of PAHSAs in the study of colitis.
Snippet: Cells were transfected overnight with mGPR40 (Origene #MC212962) or mGPR120 (R&D #RDC0803) and washed 2X with DMEM prior to treatment with control (DMEM-0.5% FBS) or 1µM TUG- 891 with 0, 1 or 100µM AH7614 for 18 hours. ... Cite SaveSaving
β-arrestin recruitment and biased agonism at free fatty acid receptor 1
Mancini, Bertrand, Vivot et al
J. Biol. Chem. (2015)
AI Summary: OriGene contributed to this study by providing the murine GPR40 cDNA (pCMV6-mGPR40; SKU MC212962), which was used to investigate GPR40 signaling pathways and β-arrestin recruitment.
Snippet: TAK-875 was purchased from Selleckchem (Houston, TX, USA);palmitate and oleate were obtained from Sigma (St. Louis, MO, USA). Murine GPR40 cDNA was purchased from OriGene (pCMV6-mGPR40;SKU MC212962). The GPR40-GFP10 fusion Page 3. ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products