Gm94 (NM_001033280) Mouse Untagged Clone

SKU
MC212755
Gm94 (untagged) - Mouse predicted gene 94 (Gm94), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gm94
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212755 representing NM_001033280
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGTCTCAGTTCTTCGCCTGATGGTTGTCCTGGGACTGAGTGCCCTAATCCTGACATGCCGGGCAG
ATGACAACCCAAATGAAAATGACAACCCAGACAGCAAGCCCGATGACTCTAGTAAAAATCCAGAGCCAGG
TTTCCCCAAATTCTTAAGCATCCTGGGTTCAGAGATCATTGAAAATGCAGTGGACTTCATCCTTCGCTCC
ATGTCCAGAGGATCAAGTTTTATGGAACTTGAAGGCGATCCTGGACAGCAACCTTCAAAAGTGACCTCCT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001033280
Insert Size 282 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033280.2, NP_001028452.1
RefSeq Size 748 bp
RefSeq ORF 282 bp
Locus ID 225443
UniProt ID Q3V2D2
Cytogenetics 18 B3
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033280" in other vectors (4)
SKU Description Size Price
MG214017 Gm94 (tGFP-tagged) - Mouse predicted gene 94 (Gm94), (10ug) 10 ug
$350.00
MR214017 Gm94 (Myc-DDK-tagged) - Mouse predicted gene 94 (Gm94) 10 ug
$289.00
MR214017L3 Lenti ORF clone of Gm94 (Myc-DDK-tagged) - Mouse predicted gene 94 (Gm94) 10 ug
$450.00
MR214017L4 Lenti ORF clone of Gm94 (mGFP-tagged) - Mouse predicted gene 94 (Gm94) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products