OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Calcoco2 (NM_029755) Mouse Untagged Clone

Be the first to review this product
SKU
MC211780
Calcoco2 (untagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Calcoco2 or NM_029755"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Calcoco2
Synonyms 2410154J16Rik; C77254; Ndp52; Ndp52l1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211780 representing NM_029755
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCAGTGCCCCATACCTACCTTGCTGGAACATGGCAACTTCTCTCAGGTCCTGTTTAACAATGTGG
AGAAGTTCTATGCTCCTAGAGGAGATATCATGTGCTATTACACCCTCACTGAAAAGTTCATCCCTCGACG
CAAGGACTGGATTGGCATCTTTAAAGTAGGGTGGAAGACCACTCAGGAGTATTATACCTTCATGTGGGCT
CCCTTGCCAAAAGACCAAAACAAGGATTCAGCCACACAGCAGGAAATCCAATTCAAAGCTTATTACCTTC
CCAAGGATGTGGAGCGCTACCAGTTCTGCTATGTGGATGAAGATGGTTTAGTCCGGGGAACAAGTGTCCC
TTTCCAGTTTTGTCCAGACCCTGACGAGGACATAATGGTTGTTATCAATAAGGAAAAGGTAGAAGAGATG
GAACAGCTCAGTGAGGAGCTTTACCAACAAAACCAGGAGCTGAAAGACAAGTACGCTGACCTCCATGAGC
AGCTACAGAGGAAGCAGGTGGCACTGGAAGCAACACAGAGGGTCAATAAGACCTTAGAACACAAAGTGGA
AGAGAAGGCCTCCTGGGAGAAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAG
GCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCT
GGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGA
AGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGAAAGAGAAGGCCTCCTGGGAGGAAGAGAAG
GCCTCCTGGGAGAAAGAGAAGGCCCCCTGGGAGGTAGAGAAGGCCCCCTGGAAGGAAGTGAAGGCCTATT
GGTGGAATGATCTGCACCGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_029755
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_029755.3, NP_084031.2
RefSeq Size 1556 bp
RefSeq ORF 933 bp
Locus ID 76815
Cytogenetics 11 59.4 cM
Summary Xenophagy-specific receptor required for autophagy-mediated intracellular bacteria degradation (By similarity). Acts as an effector protein of galectin-sensed membrane damage that restricts the proliferation of infecting pathogens upon entry into the cytosol by targeting LGALS8-associated bacteria for autophagy (By similarity). Initially orchestrates bacteria targeting to autophagosomes and subsequently ensures pathogen degradation by regulating pathogen-containing autophagosome maturation (By similarity). Bacteria targeting to autophagosomes relies on its interaction with MAP1LC3A, MAP1LC3B and/or GABARAPL2, whereas regulation of pathogen-containing autophagosome maturation requires the interaction with MAP3LC3C (By similarity). May play a role in ruffle formation and actin cytoskeleton organization and seems to negatively regulate constitutive secretion (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_029755" in other vectors (4)
SKU Description Size Price
MG216075 Calcoco2 (tGFP-tagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2) transcript variant 1, (10ug) 10 ug
$500.00
MR216075 Calcoco2 (Myc-DDK-tagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2), transcript variant 1 10 ug
$289.00 $300.00
MR216075L3 Lenti ORF clone of Calcoco2 (Myc-DDK-tagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2), transcript variant 1 10 ug
$600.00
MR216075L4 Lenti ORF clone of Calcoco2 (mGFP-tagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products