Cypt12 (NM_029289) Mouse Untagged Clone

SKU
MC211626
Cypt12 (untagged) - Mouse cysteine-rich perinuclear theca 12 (Cypt12), (10ug)
  $165.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cypt12
Synonyms 1700001F04Rik; AV209098
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211626 representing NM_029289
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACGTGTGGCCAAGAGAGCGCCTGAGCCGACTACTGCTGCTGCAGCAGCAAGATCCAAGCAGCGGA
ATCGTAGAGCTTCCTATGGTCGAAGGTGCAAGAACTCCAACAAGAACCAACGTGCTTCGCGTCGTCGCAA
AAGCTGTGCTGAGATAATGAGAAAGGGGAAGAGAGGGCGTCAACAGGCATCGAAAGGGAAGAAAGCCATC
AAAGTAAGAATTCTTAAAGAAGCTAGTCAAAATGCTCTAGCATTAGTCATCCATGAGCCAGTGAATGAGA
ATGTCAGCTTGACACCACCAGAAGTTCCATCGTGCCCTGAAAACTCCCCAGTTCCTAAGGAAGACCTGGT
CAGCTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_029289
Insert Size 360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_029289.1, NP_083565.1
RefSeq Size 509 bp
RefSeq ORF 360 bp
Locus ID 75439
Cytogenetics 3 A1
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_029289" in other vectors (4)
SKU Description Size Price
MG213955 Cypt12 (tGFP-tagged) - Mouse cysteine-rich perinuclear theca 12 (Cypt12), (10ug) 10 ug
$350.00
MR213955 Cypt12 (Myc-DDK-tagged) - Mouse cysteine-rich perinuclear theca 12 (Cypt12) 10 ug
$289.00
MR213955L3 Lenti ORF clone of Cypt12 (Myc-DDK-tagged) - Mouse cysteine-rich perinuclear theca 12 (Cypt12) 10 ug
$450.00
MR213955L4 Lenti ORF clone of Cypt12 (mGFP-tagged) - Mouse cysteine-rich perinuclear theca 12 (Cypt12) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products